Microorganisms
Lacticaseibacillus casei was obtained from department of Microbiology in a faculty of Agriculture, to examine its potential to produce lactic acid as a reference strain. The strain was stored at − 20 °C by mixing the fresh sub-cultures with 20% glycerol [9]. Before testing, the strain was sub-cultured at appropriate temperature in sterile MRS agar medium.
Raw materials
Salted cheese whey (contained total solids 10.5%; lactose 4.9%, protein 0.8%, fat 0.12%, salt 4%, and ash 0.09%) was obtained from Dairy Science department in a faculty of Agriculture and used for isolation of LAB. Whey permeate (5% lactose) was obtained from Dairy Industry Unit in a research center. Chemical composition of raw materials was determined according to [10]. Salted whey and whey permeate were deproteinized by heating as described by [11].
Isolation of LAB from salted cheese whey
A sample of salted cheese whey was applied using plate count method on selective agar media, the M17 agar medium for lactococci and enteroccoci [12], MRS medium for lactobacilli [13]. Developed typical colonies were picked up and purified twice. Pure cultures were grown on M17 or MRS agar at 37 °C for 24 h and stored at − 20 °C with 20% glycerol [9]. Before using the isolates, frozen cultures were sub-cultured overnight.
Morphological and biochemical characterization of LAB isolates
Isolates were cultivated on M17 or MRS agar media at 37 °C for 24 h and used for identification and fermentation process. LAB were phenotypically identified based on morphological and biochemical characters; Gram staining, oxygen requirements, catalase activity [14], litmus milk test [15], CO2 production from glucose and fermentation of sugars (sucrose, mannitol, rhamnose, sorbitol, and maltose), as well as growth at 10, 45, and 50 °C in 6.5% NaCl and pH 9.6 according to [16], Phenol red broth base medium [17] is recommended for carbohydrate fermentation. Growth of bacterial isolates at deferent temperatures 10, 45, and 50 °C in 6.5% NaCl and pH 9.6 was tested in M17 or MRS.
Screening of isolates for lactic acid production
Different set of batches were carried out to study the ability of bacterial isolates to produce lactic acid using different fermentation media containing (salted cheese whey, whey permeate, as well as mixture of both (1:1)) supplemented with SN nutrients (manganese sulphate 20 mg/l, yeast extract 0.75%) at temperature 37 °C for 36 h using inoculum size 4%. All batches were carried out in conical flasks containing 100 ml working volume at static state fermentation.
Molecular identification of efficient LA-producing isolates
Bacterial DNA extraction
Bacterial isolates were grown in broth medium for 24 h at 37 °C then harvested by centrifugation at 12,000 g for 5 min. After washing of bacterial pellets for three times using 0.85% NaCl saline, genomic deoxyribonucleic acid (DNA) was extracted using Gene JET genomic DNA purification Kit (Thermo scientific, Lithuania) [18]. DNA yields and purity were checked using both nanodrop spectrophotometer and agarose gel electrophoresis.
Bacterial fingerprints and genotypic diversity
The BOX-PCR fingerprints of bacteria were generated according to [19] using BOXA1R primer (CTACGGCAAGGCGACGCTGACG). Eight microliters of the PCR products were separated by 1.5% agarose gel electrophoresis in 0.5 X TBE-buffer for 4 h (50 V). The BOX-PCR fingerprints patterns were checked and compared visually.
Identification of bacterial isolates by 16S rRNA gene sequencing
The 16S ribosomal ribonucleic acid (rRNA) gene fragments of 6 lactic acid-producing isolates were amplified using the universal primers F-27 (5′-AGAGTTTGATCMTGGCTCAG-3′) and R1494 (5′-CTACGGYTACCTTGTTACGAC-3′) using PCR machine (Bio-rad T100 thermal cycler). PCR products were checked via agarose gel electrophoresis then purified using gel extraction kit (Thermo scientific, Lithuania) and sequenced by Macrogen, Koria.
Phylogenic analysis of bacterial isolates
The evolutionary history was inferred using the neighbor-joining method. The tree was computed using the maximum composite likelihood method. The analysis involved 28 nucleotide sequences of which 6 sequences of 16S rRNA gene amplified from bacterial isolates of current study while 22 sequences representing the most similar hits were obtained from the National Center for Biotechnology Information (NCBI) gene bank data base. Evolutionary analyses were conducted in MEGA5 software.
Optimization of parameters for LA production using immobilized cells
Optimization of process parameters for LA production using the most efficient two bacterial isolates (Ent.58 and Ent.68) and L. casei were carried out in batches in 250 ml conical flask containing the fermentation media (100 ml working volume of whey permeate and salted cheese whey (1:1)) using immobilized cells and repeated batches technique to study the effects of calcium carbonate (CaCO3, 0.5%), incubation temperature (30, 37, and 45 °C), inoculum size (2–4%), and different concentrations of sucrose (5 and 10%) during fermentation for 36 h under static state fermentation conditions. Bacterial cultures were examined in M17and MRS synthetic broth media for biomass production, respectively. Conical flasks (250 ml) containing 100 ml of media were inoculated with freshly activated 4% (v/v) inoculum and incubated at 37 °C for 24 h.
Immobilization and cell entrapment method of bacterial cells
According to [20], immobilization of bacterial isolates (Ent.58, Ent.68, and dual of them) and L. casei was conducted as follows; cells were harvested by centrifugation at 4000 rpm for 15 min at 4 °C and washed by 0.1% (w/v) sterile water peptone. The pellets were suspended in 5 ml of 0.1% (w/v) sterile water peptone and mixed with equal volume of sodium alginate solution to yield a final alginate concentration of 2%. The mixture was gently added drop-wisely to sterile stirred 1% CaCl2 through a needle, where alginate drops have solidified by CaCl2 forming beads which entrapped bacterial cells. After 30 min of jellification, beads in diameter 2 mm were washed twice with sterile saline solution to remove un-immobilized cells and excess calcium ions. Then, the beads were rinsed with 0.1% sterile water peptone and stored at 4 °C. Analytical growth of beads was carried out to determine the count of immobilized cells in one gram beads.
Free and immobilized cells counting
Count of immobilized cells was enumerated; beads (0.1 g) were liquefied in 100 ml of 1% sterilized sodium citrate solution (pH 6.0) and serially diluted in 0.1% water peptone [21]. Dilutions of free and immobilized cells were transferred into plates and counts were determined using M17 or MRS agar according to [13]. The plates were incubated at 37 °C for 48 h under anaerobic conditions [22].
Repeated batches using immobilized cells for LA production
To find out the optimal incubation time for the maximal lactic acid production, the fermentative medium was inoculated with immobilized bacterial cultures (Ent.58 and Ent.68 and dual of them as well as L. casei) and incubated for 24, 36, 72, and 96 h. Repeated batch (semi continuous) fermentation in 250 ml conical flasks with working volume of 100 ml were used. Inoculum size of 4% was added to each flask containing 100 ml of salted cheese whey and whey permeate mixture supplemented with SN and incubated at 37 °C for 18, 27, 54, and 72 days representing 18 runs (each run 24, 36, 72, or 96 h, in which 100 ml of fermentation medium were added and 100 ml fermentation culture were withdrawn). At the end of each period, lactic acid production was estimated according to the higher production of LA, as well as LA yield and efficiency (conversion ratio) were calculated as follows:
$$\mathrm{Lactic}\ \mathrm{acid}\ \mathrm{yield}\ \left(\%\right)=\frac{\mathrm{Lactic}\ \mathrm{acid}\ \mathrm{production}}{\mathrm{Sugar}\ \mathrm{utilized}}\times 100$$
$$\mathrm{Conversion}\ \mathrm{ratio}\ \left(\%\right)=\frac{\mathrm{Initial}\ \mathrm{sugar}\ \mathrm{conc}.-\mathrm{residual}\ \mathrm{sugar}\ \mathrm{conc}.}{\mathrm{Initial}\ \mathrm{sugar}\ \mathrm{conc}.}\times 100$$
Analytical methods
Lactose was measured by an enzymatic method according to [23]. The sample was diluted in distilled water (1: 100), 80 μl were placed in spectrophotometer cuvette, then 20 μl of distilled water, 200 μl of citrate buffer, and 50 μl of lactozyme were added. The mixture was shaken and incubated at 25 °C for 20 min for lactose hydrolysis. Then Peridochrom (2 ml) was added and incubated at 25 °C for 50 min, the developed color was measured at 510 nm in spectrophotometer, and blank solution without lactose was used as well. Reducing sugar was measured using 3,5-dinitrosalicylic acid (DNS) method of [24] as g/l, DNS reagent contains (DNS 1%, phenol 0.2%, sodium sulfite 0.05%, sodium hydroxide 1% and Rochelle salt; sodium potassium tartrate 20%). Three milliliters of DNS reagent were added to 2 ml of aliquot sample in a test tube; the mixture was heated in a boiling water bath for 5 min then cooled to room temperature. Light absorbance of sample and reagent blank was determined using spectrophotometer at 640 nm. Lactic acid was determined using high performance liquid chromatograph (HPLC), before HPLC, samples were filtered using 0.20 μm membrane filters. A Bio-Rad Aminex HPX-87H column (300 × 7.8 mm) packed with a sulphonated divinyl benzene-styrene copolymer was used for the separation of compounds. The mobile phase (0.005 M H2SO4) was fed at a flow rate of 0.6 ml/min and temperature was kept at 50 °C. After HPLC, lactate concentration was spectrophotometrically estimated using an enzymatic kit (lactate-liquizyme, Schiffgraben, Hannover, Germany); 1 ml of reagent and 10 μl of sample were mixed and incubated at 37 °C for 5 min, then light absorbance was measured at 546 nm wave length for sample and standard blank reagent (lactate conc. = (absorbance of sample / absorbance of standard) × 10) [25].
Statistical analysis
All experiments were achieved in triplicates in a completely randomized design. The significance of the main factors was estimated by analysis of variance (ANOVA). The significance of variance treatments was assessed by Duncan’s multiple range test (P < 0.05). Analyses were estimated using a software package “Costat,” a product of Cohort Software Inc., Berkeley, California. All results were reported as means of three replications. Standard deviation (SD) and least significant difference (LSD) were calculated.
