Skip to main content
Journal of Genetic Engineering and Biotechnology
Download PDF

Cholesterol-lowering effects and safety assessment of Lactobacillus spp. in vivo and in vitro testing for human use as probiotic from the dairy product in Egypt

Journal of Genetic Engineering and Biotechnology volume 20, Article number: 144 (2022) Cite this article

Abstract

Background

The toxicity profile of lactobacilli may be strain dependent, so it should be considered for safe utilization of probiotics. Further, in vivo studies are necessary to evaluate their safety.

Result

The ability of various probiotic strains to hydrolyze bile salts has been confirmed without noticeable hemolytic activity. Results revealed the presence of α-glucosidase, β-glucosidase, α-galactosidase, and β-galactosidase activity in all investigated isolates, while none of the isolates produced the carcinogenic enzyme β-glucuronidase. The probiotic strains exhibited remarkable cholesterol-lowering impact. Also, we found no evidence of chronic toxicity under the experimental conditions based on gross pathological examination of the viscera and study of the spleen and liver weight ratios. These findings indicated that the investigated strains, either alone or combined with their metabolites, had no obvious adverse effect on the mice's general health status.

Conclusion

There is prove that the investigated probiotic strains are safe to be utilized for enhancing of the growth performance and are free of adverse side effects.

Background

Safety aspects of probiotics of LAB

The acidification of milk depends on efficient conversion of the milk-sugar lactose to lactic acid which contributes to the extended shelf-life fermented milk products by preventing the outgrowth of pathogenic and spoilage organisms. The lactic acid bacteria (LAB) are belonging to probiotics that have several beneficial effects on human health [1]. It has been suggested that supplementation of dairy products with Lactobacillus spp. exerts a significant influence on microbial metabolism in the colon by reducing fecal β-glucuronidase and nitroreductase activities related to the release and formation of toxic compounds in the colon. The safety of probiotic items is evaluated based on the phenotypic and genotypic characteristics and microbial measures [2, 3]. The majority of data are from opportunistic pathogenic enterococci, while few reports on lactococci and lactobacilli. Vancomycin-resistant enterococci (VRE) are disseminated via the food chain, which have emerged in the last decade as a frequent cause of nosocomial infections [4, 5]. A previous study investigated the in vitro susceptibility of Enterococcus faecium strains isolated from food products to a diverse array of antibiotics [6]. The phenotypic analysis was employed to determine their resistance to a diverse array of antibiotics; enterococci are commonly considered intrinsically resistant to low levels of gentamicin, enterococci isolated from milk and cheese were screened for gentamicin resistance [7]. Numerous dairy isolates have been shown to have a high level of gentamicin resistance. The molecular components of gentamicin resistance in Enterococcus isolates from creatures, foods, and patients were determined [8]. It has been proposed that enterococci isolated from humans, retail food, and cultivated creatures have similar gentamicin resistance. Moreover, the spread of gentamicin-resistant enterococci from creatures to people through the food supply was demonstrated. Tetracycline resistance could be linked to the presence of tet (M) genes in enterococcal isolates [9].

Given the increasing promotion of probiotic strains of Lactobacillus and Bifidobacterium in consumer products, we anticipate that widespread probiotic utilization may enhance corpulence by altering the intestinal microbiome [10, 11]. On the other hand, for at least 30 years, probiotics have been employed to manipulate the gut microbiota to boost growth in farm animals. Indeed, Lactobacillus acidophilus is often commonly used in agriculture. All this information unequivocally proposes that Lactobacillus-containing probiotics (LCP) may affect weight control in people and creatures. Numerous studies have examined the effects of Lactobacillus-containing probiotics (LCP) on weight, but subsequent information indicates that this effect is, at best, species-specific [11,12,13].

Methods

Probiotic characterization by molecular tools

The bile salt hydrolase gene was detected in superior isolates by polymerase chain reaction (PCR) using bsh primers (5′ GGATTGTGTATTGCGGGATT 3′) and (5′ AGTCCGCCCATTCCTCTACT 3′) following the method described by [14]. The PCR reaction cycles were as follows: initial denaturation at 95 °C for 4 min followed by 35 consecutive cycles of 94 °C for 1 min, 55 °C for 40 s, 72 °C for 2 min and final extension of 72 °C for 10 min. The resultant PCR products were analyzed by agarose gel electrophoresis.

Studying enzymatic activity of Lactobacillus isolates

The API ZYM pack (bio-Mérieux, France) was used to investigate the enzymatic profiles of Lactobacillus isolates according to the manufacturer instructions. Each isolate was grown overnight in MRS broth at 37 °C. After incubation, cells were collected by centrifugation and resuspended to be inoculated into API ZYM kit microcupules. Afterwards, the inoculated strips were covered and incubated at 37 °C for 4 °h. Subsequently, 30 °μl of each reagent (ZYM A and ZYM B; BioMerieux, France) were added to each microcupules and incubated for 5 min. Results were recorded according to the manufacturer’s instructions using the scale from 0 to 5 based on the visual color intensity.

Antibiotics susceptibility of Lactobacillus isolates

The Kirby-Bauer disk diffusion method was used to screen lactobacilli isolates for antimicrobial susceptibility to 15 antibiotics: ampicillin/sulbactam, amoxicillin/clavulanic acid, clarithromycin, erythromycin, nalidixic acid, trimethoprim/sulphamethoxazole, ciprofloxacin, tetracycline, vancomycin, and rifampicin. According to clinical laboratory standards institute. In brief, a few fresh colonies of each strain were picked with a wire loop and incubated in MRS broth. The inoculated tubes were then incubated at 35 °C for 2 to 5 h till the turbidity equivalent to 0.5 McFarland standards was developed. The suspension is then diluted (1:10) with saline to yield a uniform bacterial suspension. Muller Hinton agar plates were then inoculated with bacterial suspension using a sterile cotton swab. The discs were firmly applied to the surface of the agar plate using aseptic techniques with centers at least 24 mm apart. The plates were incubated at 35 °C and examined after 16–18 h.

In vivo studies of Lactobacillus isolates

In this investigation, three probiotic Lactobacillus spp. isolates identified as L. case, L. lactis, and L. acidophilus were employed in animal feed. Cultures grown in MRS broth were concentrated by centrifugation, and the cell pellets were resuspended in a diluent after three washes to give a final concentration of 108 CFU/ml. These preparations were then added to the drinking water given to the mice at a final concentration of 20% (v/v). In another set (control), drinking water without bacterial suspensions given to the mice under the same conditions.

Animals and diets

Mice weighing 13–17 g from a private laboratory (creative lab) were housed in groups of 5 males and 5 females per cage. A regular light-dark cycle and a controlled atmosphere with a temperature of 22 °C and relative humidity of 55% were maintained throughout the study. The animals were given free access to feed, which may be either a barley-based basal diet or an enriched conventional feed (mice were provided with drinking water).

Experimental design

In this study, five groups of mice were evaluated to assess the safety of probiotic isolates. Namely, G1 was subjected to a commercial strain of L. plantarum (positive control); G2 received drinking water without any probiotics (negative control); G3 was subjected to L. Acidophillus; G4 was subjected to L. casei and G5 was subjected to L. lactis. The mice were acclimatized to the experimental conditions for 24 h. Supplemented drinking water and feed were changed daily. The treatments for the toxicology study lasted for 4 weeks, whereas the growth-promoting treatment lasted 10 days. Hair luster was observed at the end of the treatment period, and each mouse’s body weight was recorded daily. All animals were murdered via cervical separation on the final day of the test.

Evaluation of growth performance

Daily body weight measurements were taken using a mouse balance (Sartorius). The weight gain (WG) was expressed as the mean of each mouse's final weight minus its initial weight. The specific growth rate (SGR) was expressed as the daily weight gain. Feed intake (FI) and water intake were monitored daily for each cage and expressed per animal for the total period by dividing feed or water consumption by the number of animals. The consumption index (CI) was calculated as the ratio of FI/WG [15]. Hemoglobin and liver enzyme levels were measured to determine side effects.

Results and discussions

Probiotic characterization by molecular tools

A bile salt hydrolase gene from L. Plantarum was utilized as a potential food-grade determination marker to develop a novel vector for lactic acid microbes [16]. Using a primer for the bile salt hydrolysis gene to confirm superior isolates’ probiotic characteristics resulted in a positive result (Fig. 1), demonstrating that isolates can hydrolyze bile salt as a probiotic trait [14].

Fig. 1
figure 1

Gel electrophoresis for Bile salt hydrolysis gene S1, S2, and S3 bands are probiotic bacterial isolates, beside band of positive control

Full size image

The cholesterol-lowering effects of lactic acid bacteria and mechanism

The ability to hydrolyze bile salts has been added to the criteria for determining probiotic strains with cholesterol-lowering effects, as numerous non-deconjugating strains were unable to evacuate cholesterol from the culture medium [17]. Several investigations on the hypocholesterolemic effects of BSH-producing lactic acid bacteria in vivo have prompted increased interest in maintaining cholesterol levels in healthy individuals or conceivable applications for hypercholesterolemic individuals. In this case, BSH-positive bacterial cells shows potential for controlling blood cholesterol levels. In any case, additional considerations revealed that probiotics had negligible effects on cholesterol-lowering impacts, hence casting doubt on the hypocholesterolemic claim. Many researchers proposed that probiotics have cholesterol reduction effects. However, the mechanism of this effect could not be explained definitely. Two hypotheses are trying to explain the mechanism. One of them is that bacteria may bind or incorporate cholesterol directly into the cell membrane which confirmed by evidences saying that (LAB) lactic acid bacteria are non-pathogenic and safe microbes that generate numerous mature food products. It transforms glucose into lactic acid, ethanol, and CO2, all of which improve the quality, surface, and smell of fermented items [18]. Microbial cells normally absorb metal particles due to their utility for creating cell layers [19]. LAB has recently been applied during metal particle restriction, despite the results of reviews investigating the coupling capacity of metal particles of different microorganisms. Have performed a broad review of past studies on the absorption limits of individual clusters of microorganisms [20]. The other one is, bile salt hydrolysis enzymes deconjugate the bile salts, which are more likely to be exerted, resulting in increased cholesterol breakdown [2, 21, 22]. Using a primer for the bile salt hydrolysis gene to confirm superior isolates’ probiotic characteristics resulted in a positive result, demonstrating that isolates can hydrolyze bile salt as a probiotic trait [14] confirmed by a study on the reduction of cholesterol showed that Lactobacillus reuteri decreased total cholesterol by 38% when given to mice for 7 days at the rate of 104 cells/day. This dose of Lactobacillus reuteri caused a 40% reduction in triglycerides and a 20% increase in the ratio of high-density lipoprotein to low-density lipoprotein without bacterial translocation of the native microflora into the spleen and liver [23]. Report to provide quantitative evidence of the dose-dependent effect of Lactobacillus sp. Agreeing with Shiuh et al., with a minimal effective dose of 6 × 108 CFU for 3 days, without any exception, the fecal rotavirus concentrations of all eight patients in the high-dose group declined by 86% after 3 days when compared with those before administration [17, 24, 25].

Enzymatic activities of Lactobacillus isolates

The clarification of Lactobacillus bacterial enzymes may aid in its identification, taxonomic placement, and increased utilization in the dairy industry and improve our understanding of its effect on bacterial metabolism and gut function. In the present study, API ZYM kit was used to detect 19 different hydrolases from Lactobacillus spp. Results revealed the presence of α-glucosidase, β-glucosidase, α-galactosidase, and β-galactosidase in all investigated isolates, while none of the isolates produced the carcinogenic protein β-glucuronidase. The enzymatic profile of the investigated isolates is shown in Table 1. These results match those found in a previous study [26, 27]. Similarly, β-galactosidase was found in Lactobacillus isolated from fermented oil, as previously reported [26]. This rapid and simple method might be useful for classifying probiotic bacteria [6]. Enzyme generation by isolates was an imperative measure in its determination since microorganisms can deliver carcinogenic enzymes such as β-glucuronidase [28].

Table 1 Enzyme activity of isolated Lactobacillus spp.
Full size table

Antibiotics susceptibility of Lactobacillus isolates

Lactic acid bacteria are broadly utilized as probiotics or starter cultures and can be a repository of antimicrobial resistance genes. Thus, using LAB increase the possibility of antibiotic resistance genes being transferred to lactic acid microorganisms and other pathogenic microbes. In recent years, there has been an increased emphasis on nutrition as a vehicle for antimicrobial resistance genes [29,30,31]. A recent study provided an overview of the techniques available for studying mobile DNA transfer in microbial communities [32]. However, very few systematic studies have been conducted on LAB acquired antibiotic resistance through food.

Exchange of resistance to antimicrobial substances is a basic component in Lactobacillus adaptation and survival in particular environments. Among the resistance components in use, protein inactivation of the antimicrobial, restricted antimicrobial effect, dynamic trade of anti-microbials, or target alteration may be highlighted [33]. For a variety of lactobacilli, exceptionally tall frequencies of unconstrained transformations have been observed in response to nitrofurazone, kanamycin, and streptomycin [9]. Another study was performed to establish the levels of susceptibility of Lactobacillus spp. to various antimicrobial agents, revealing species dependence [34]. The resistance spectrum of Bifidobacterium was previously described [31]. The investigated bifidobacteria (probiotics) were susceptible to many antibiotics. There was discovered resistance, some of it most likely intrinsic [35]. It was reported that L. lactis strains were sensitive to amikacin, ampicillin, 1st generation cephalosporin, and many antibiotics [4]. Numerous drug efflux proteins were found in L. lactis subsp. lactis [34], including an ABC transporter and a proton motive force-dependent drug transporter. The resistance against vancomycin is due to the proximity of d-alanine: d-alanine ligase-related proteins [36]. Fifteen strains of Streptococcus thermophiles isolated from yogurt cultures showed varying resistance levels to different antibiotics [37]. Also, S. thermophile strains were previously examined to determine their antibiotic resistance patterns and plasmid carriage [3]. Most strains of S. thermophilus were resistant to gentamicin. However, no correlation was observed between the resistance to antibiotics and the occurrence of plasmids in some strains. The antibiotic resistance and incidence of Enterococcus species were studied in a white cheese [38]. The Scientific Committee on Animal Nutrition (SCAN) issued a 2002 opinion on the criteria to determine the safety of microorganisms resistant to antibiotics of human clinical and veterinary importance (European Commission 2002). It has been reported that all bacterial products intended for use as auxiliary substances must be inspected to determine the component strain(s)’ resistance to a considerable extent of antimicrobial [39]. Such tests must be conducted consistently and according to internationally accepted and standardized procedures [40, 41].

Effect of supplementation with Lactobacillus cultures on body weight

This study focused on mice’s safety, health, and growth performance receiving these Lactobacillus spp. daily for 2 or 4 weeks. With a conventional diet, there was no significant difference in the body weight among groups. Regardless of the lactobacilli strains utilized, no significant change in WG was observed while using a barley diet. The difference between the WG in the mice given water supplemented with lactobacilli strains and in those receiving waters in previous table groups 1, 3, 4, and 5 supplemented with different species of Lactobacillus and group 2 as control no significant difference in body weight and hemoglobin content. There was no significant difference between feeding of pre- and post-lactobacillus spp. A previous study demonstrated a significant beneficial effect on weight loss and a 45% lower risk of becoming press inadequate after 12 months of probiotic- and prebiotic-fortified milk consumption while no impact was noticed on person press insufficiency markers, B12 and folate included initially a significant proportion of children who were anemic and B12 and folate-deficient [39, 42]. In a previous study of no anemic healthy young women with low iron status, viable lyophilized Lactobacillus Plantarum added to 1 test meal did not enhance iron absorption [43,44,45].

Growth performance parameter after feeding with Lactobacillus

Effect of feeding with probiotic lactobacillus spp. on growth and liver enzyme in vivo

Although it has been shown that most Lactobacillus species (e.g., L. acidophilus, L. lactis and L. casei, and reference strain lactobacillus Plantarum) are non-pathogenic and do not cause acute oral toxicity for animals (see Tables 2, 3, and 4), it has been reported that it is important to check the safety of each probiotic strain, as the toxicity profile may be strain-dependent [17]. For example, it has been demonstrated an increase in the liver or spleen weight ratios of mice fed a strain of L. Plantarum (dead or live cells) [42]. Young mice were used in this study to reinforce any potential toxic impact.

Table 2 No. of isolate resistance to antibiotics of the representative strains of lactic acid bacteria isolated from dairy products
Full size table
Table 3 The effect of lactobacillus cultures on body weight in experimental mice for 10 days
Full size table
Table 4 Hemoglobin content (g/DL) in mice fed with lactobacillus sp.
Full size table

We found no evidence of chronic toxicity under these experimental conditions based on gross pathological examination of the viscera or study of the spleen or liver weight ratios. These findings indicated that these strains, either alone or combined with their metabolites, had no obvious adverse effect on the mice's general health status, as shown in Tables 2, 3, and 4. Figures 2, 3, 4, and 5. For several centuries, LAB have been used in fermented foods and nourishes without obvious adverse effects (61). They are therefore classified as “generally recognized as safe”: GRAS [46,47,48,49].

Fig. 2
figure 2

The effect of lactobacillus cultures on body weight in Experimental mice for 10 days

Full size image
Fig. 3
figure 3

Represent hemoglobin content (g/DL) in mice fed with Lactobacillus sp

Full size image
Fig. 4
figure 4

Represent liver enzymes GPT (ALT) μ/l parameter before feeding with Lactobacillus spp.

Full size image
Fig. 5
figure 5

Represent liver enzymes GPT (ALT) μ/l parameter before after feeding with Lactobacillus spp.

Full size image

Effect of lactobacillus spp. on liver enzyme

A successful growth promoter must enhance growth performance and be free of adverse side effects. For several centuries, LAB have been used in matured foods and feeds without obvious adverse effects [39, 47]. Therefore, they are classified as “generally recognized as safe”: GRAS [46, 49, 50]. Nevertheless, from the statistical study of e tests, we found no significant difference in liver enzyme parameters between before and after feeding as showing in Figs. 5, 6, and 7 (see Tables 5, 6, 7, and 8). When individuals have a chronic insurmountable condition, such as viral contamination, harmful injury, or alcoholic/non-alcoholic fatty liver, the serum levels of AST, ALT, and g-GTP, which serve as hepatic markers, are dramatically increased. Non-alcoholic fatty liver disease is a prevalent liver pathology encompassing a broad histologic spectrum ranging from simple steatosis to non-alcoholic steatohepatitis [12, 51]. Lactobacillus sp. Have been demonstrated to effectively advance liver function merely in creature show tests [39, 52]. We observed that type B yogurt contributed to a decrease in these liver biomarkers, particularly when patients with AST and ALT levels between 20 and 80 IU/L were evaluated (12–25% diminish) [53, 54].

Fig. 6
figure 6

liver enzyme GOT (AST) μ/l parameter before feeding with Lactobacillus

Full size image
Fig. 7
figure 7

Liver enzyme GOT (AST) μ/l parameter after feeding with Lactobacillus sp

Full size image
Table 5 Liver enzymes GPT (ALT) u/l parameter before feeding with Lactobacillus spp.
Full size table
Table 6 Liver enzyme GPT (ALT) U/l parameter after feeding with Lactobacillus spp.
Full size table
Table 7 Liver enzyme GOT (AST) u/l parameter before feeding with Lactobacillus
Full size table
Table 8 Liver enzyme GOT (AST) u/l parameter after feeding with Lactobacillus
Full size table

Sort A yogurt decreased the ALT value. The current study is the primary report of a trial in which a certain lactobacillus strain was found to move forward liver function. Another study revealed that Probiotic isolate possesses the highest potential of (48%) cholesterol reduction compared to the other isolates. Thus, the use of these LAB isolates for yoghurt-making can offer the value addition of lowering cholesterol and vitamin B12 fortification in fermented food [23, 55,56,57].

Conclusion

The present study showed that the dairy product is a source of potential probiotic strains of LAB. The isolates meet several functional features to be considered a suitable probiotic for application in food fermentation where isolated bacteria can tolerate acidic medium bile salt, a favorable enzymatic activity, and no hemolytic activity. So, we consider it a great potential probiotic character and safe for human use. There is prove that probiotic strains utilized as commercial microorganism are safe for utilize and considered a successful growth promoter enhances growth performance and is free of adverse side-effects. The security of probiotic items is evaluated based on the phenotypic and genotypic characteristics as well as measurements of the microbe characterize. Lactobacillus besides the gene responsible for hydrolyzing bile salts confirm the probiotic character of superior isolates and suggesting two hypotheses trying to explain the mechanism. One of them is that bacteria may bind or incorporate cholesterol directly into the cell membrane the other one is, bile salt hydrolysis enzymes deconjugate the bile salts, which are more likely to be exerted, resulting in increased cholesterol breakdown.

Availability of data and materials

Please contact author for data requests.

Abbreviations

LAB:

Lactic acid bacteria

CFU:

Count forming unit

GRAS:

Generally recognized as safe

IU:

International unit

nmol:

Nano mole

References

  1. De Filippis F, Pasolli E, Ercolini D (2020) The food-gut axis: lactic acid bacteria and their link to food, the gut microbiome and human health. FEMS Microbiol Rev 44(4):454–489

    Article  Google Scholar 

  2. Çakır İ (2003) Laktobasillus ve Bifidobakterlerde Bazı Probiyotik Özelliklerin Belirlenmesi [Determination of some probiotic properties on lactobacilli and bifidobacteria] (PhD Thesis). Ankara University, Graduate School of Natural and Applied Sciences, Department of Food Engineering, Ankara

    Google Scholar 

  3. Kleerebezem M, Bachmann H, van Pelt-KleinJan E, Douwenga S, Smid EJ, Teusink B, van Mastrigt O (2020) Lifestyle, metabolism and environmental adaptation in Lactococcus lactis. FEMS Microbiol Rev 44(6):804–820

    Article  Google Scholar 

  4. Franz CM, Muscholl-Silberhorn AB, Yousif NM, Vancanneyt M, Swings J, Holzapfel WH (2001) Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl Environ Microbiol 67(9):4385–4389

    Article  Google Scholar 

  5. Giraffa G, Sisto F (1997) Susceptibility to vancomycin of enterococci isolated from dairy products. Lett Appl Microbiol 25(5):335–338

    Article  Google Scholar 

  6. Lee NK, Yun CW, Kim SW, Chang HI, Kang CW, Paik HD (2008) Screening of lactobacilli derived from chicken feces and partial characterization of Lactobacillus acidophilus A12 as animal probiotics. J Microbiol Biotechnol 18(2):338–342

    Google Scholar 

  7. Lopes MDFS, Ribeiro T, Martins MP, Tenreiro R, Crespo MTB (2003) Gentamicin resistance in dairy and clinical enterococcal isolates and in reference strains. J Antimicrob Chemother 52(2):214–219

    Article  Google Scholar 

  8. Donabedian SM, Thal LA, Hershberger E, Perri MB, Chow JW, Bartlett P, Jones R, Joyce K, Rossiter S, Gay K, Johnson J (2003) Molecular characterization of gentamicin-resistant enterococci in the United States: evidence of spread from animals to humans through food. J Clin Microbiol 41(3):1109–1113

    Article  Google Scholar 

  9. Huys G, D'Haene K, Collard JM, Swings J (2004) Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol 70(3):1555–1562

    Article  Google Scholar 

  10. Fujimoto J, Matsuki T, Sasamoto M, Tomii Y, Watanabe K (2008) Identification and quantification of Lactobacillus casei strain Shirota in human feces with strain-specific primers derived from randomly amplified polymorphic DNA. Int J Food Microbiol 126(1-2):210–215

    Article  Google Scholar 

  11. Chen X, Ishfaq M, Wang J (2022) Effects of Lactobacillus salivarius supplementation on the growth performance, liver function, meat quality, immune responses and Salmonella Pullorum infection resistance of broilers challenged with Aflatoxin B1. Poult Sci J 101:3

    Google Scholar 

  12. Matteoni CA, Younossi ZM, Gramlich T, Boparai N, Liu YC, McCullough AJ (1999) Nonalcoholic fatty liver disease: a spectrum of clinical and pathological severity. Gastroenterology 116(6):1413–1419

    Article  Google Scholar 

  13. Xing HC, Li LJ, Xu KJ, Shen T, Chen YB, Sheng JF, Chen Y, Fu SZ, Chen CL, Wang JG, Yan D (2006) Protective role of supplement with foreign Bifidobacterium and Lactobacillus in experimental hepatic ischemia-reperfusion injury. J Gastroenterol Hepatol 21(4):647–656

    Article  Google Scholar 

  14. Roopashri AN, Varadaraj MC (2009) Molecular characterization of native isolates of lactic acid bacteria, bifidobacteria and yeasts for beneficial attributes. Appl Microbiol Biotechnol 83(6):1115–1126

    Article  Google Scholar 

  15. Bernardeau M, Vernoux JP, Gueguen M (2002) Safety and efficacy of probiotic lactobacilli in promoting growth in post-weaning Swiss mice. Int J Food Microbiol 77(1-2):19–27

    Article  Google Scholar 

  16. Yang J, Huang K, Qin S, Wu X, Zhao Z, Chen F (2009) Antibacterial action of selenium-enriched probiotics against pathogenic Escherichia coli. Dig Dis Sci 54(2):246–254

    Article  Google Scholar 

  17. Charteris WP, Kelly PM, Morelli L, Collins JK (1998) Antibiotic susceptibility of potentially probiotic Lactobacillus species. J Food Prot 61(12):1636–1643

    Article  Google Scholar 

  18. Dalié DKD, Deschamps AM, Richard-Forget F (2010) Lactic acid bacteria–Potential for control of mould growth and mycotoxins: a review. Food Control 21(4):370–380

    Article  Google Scholar 

  19. Blackwell KJ, Singleton I, Tobin JM (1995) Metal cation uptake by yeast: a review. Appl Microbiol Biotechnol 43(4):579–584

    Article  Google Scholar 

  20. Fadl MG, Farahat MG, Mohamed ZK (2022. Received 18 Nov 2021, Accepted 12 Apr 2022) Optimum biosorption and resistance of uranium by metal-resistant bacteria isolated from rock ore. https://doi.org/10.1080/01490451.2022.2069892

    Book  Google Scholar 

  21. Chuayana JE, Ponce CV, Rivera MRB, Cabrera EC (2003) Antimicrobial activity of probiotics from milk products. Phil J Microbiol Infect Dis 32(2):71–74

    Google Scholar 

  22. Fang SB, Lee HC, Hu JJ, Hou SY, Liu HL, Fang HW (2009) Dose-dependent effect of Lactobacillus rhamnosus on quantitative reduction of faecal rotavirus shedding in children. J Trop Pediatr 55(5):297–301

    Article  Google Scholar 

  23. Walhe RA, Diwanay SS, Patole MS, Sayyed RZ, Al-Shwaiman HA, Alkhulaifi MM, Elgorban AM, Danish S, Datta R (2021) Cholesterol reduction and vitamin B12 production study on Enterococcus faecium and Lactobacillus pentosus isolated from yoghurt. Sustainability 13(11):5853

    Article  Google Scholar 

  24. Nielsen MM, Damstrup ML, Dal Thomsen A, Rasmussen SK, Hansen Å (2007) Phytase activity and degradation of phytic acid during rye bread making. Eur Food Res Technol 225(2):173–181

    Article  Google Scholar 

  25. Ziagova MG, Koukkou AI, Liakopoulou-Kyriakides M (2014) Optimization of cultural conditions of Arthrobacter sp. Sphe3 for growth-associated chromate (VI) reduction in free and immobilized cell systems. Chemosphere 95:535–540

    Article  Google Scholar 

  26. Abriouel H, Benomar N, Cobo A, Caballero N, Fuentes MÁF, Pérez-Pulido R, Gálvez A (2012) Characterization of lactic acid bacteria from naturally-fermented Manzanilla Aloreña green table olives. Food Microbiol 32(2):308–316

    Article  Google Scholar 

  27. Kamel Z, Mohamed NM, Farahat MG (2016) Optimization of culture conditions for production of B-galactosidase by Bacillus megaterium NM56 isolated from raw milk. Res J Pharm, Biol Chem Sci 7(1):366–376

    Google Scholar 

  28. Chung HS, Kim YB, Chun SL, Ji GE (1999) Screening and selection of acid and bile resistant bifidobacteria. Int J Food Microbiol 47(1-2):25–32

    Article  Google Scholar 

  29. Franz CM, Holzapfel WH, Stiles ME (1999) Enterococci at the crossroads of food safety? Int J Food Microbiol 47(1-2):1–24

    Article  Google Scholar 

  30. Leclercq R, Dutka-Malen S, Duval J, Courvalin P (1992) Vancomycin resistance gene vanC is specific to Enterococcus gallinarum. Antimicrob Agents Chemother 36(9):2005–2008

    Article  Google Scholar 

  31. Quednau M, Ahrne S, Petersson AC, Molin G (1998) Antibiotic-resistant strains of Enterococcus isolated from Swedish and Danish retailed chicken and pork. J Appl Microbiol 84(6):1163–1170

    Article  Google Scholar 

  32. Saak CC, Dinh CB, Dutton RJ (2020) Experimental approaches to tracking mobile genetic elements in microbial communities. FEMS Microbiol Rev 44(5):606–630

    Article  Google Scholar 

  33. Davies R, Roberts TA (1999) Antimicrobial susceptibility of enterococci recovered from commercial swine carcasses: effect of feed additives. Lett Appl Microbiol 29(5):327–333

    Article  Google Scholar 

  34. Danielsen M, Wind A (2003) Susceptibility of Lactobacillus spp. to antimicrobial agents. Int J Food Microbiol 82(1):1–11

    Article  Google Scholar 

  35. Kumar AM, Murugalatha N (2012) Isolation of Lactobacillus plantarum from cow milk and screening for the presence of sugar alcohol producing gene. J Microbiol Antimicrob 4(1):16–22

    Google Scholar 

  36. Çataloluk O, Gogebakan B (2004) Presence of drug resistance in intestinal lactobacilli of dairy and human origin in Turkey. FEMS Microbiol Lett 236(1):7–12

    Article  Google Scholar 

  37. Sozzi T, Smiley MB (1980) Antibiotic resistances of yogurt starter cultures Streptococcus thermophilus and Lactobacillus bulgaricus. Appl Environ Microbiol 40(5):862–865

    Article  Google Scholar 

  38. Çitak S, Yucel N, Orhan S (2004) Antibiotic resistance and incidence of Enterococcus species in Turkish white cheese. Int J Dairy Technol 57(1):27–31

    Article  Google Scholar 

  39. Putta S, Yarla NS, Lakkappa DB, Imandi SB, Malla RR, Chaitanya AK, Chari BP, Saka S, Vechalapu RR, Kamal MA, Tarasov VV (2018) Probiotics: supplements, food, pharmaceutical industry. In: Therapeutic, probiotic, and unconventional foods. London: Academic, pp 15–25

  40. De Vuyst L, Leroy F (2020) Functional role of yeasts, lactic acid bacteria and acetic acid bacteria in cocoa fermentation processes. FEMS Microbiol Rev 44(4):432–453

    Article  Google Scholar 

  41. Delzenne N, Reid G (2009) No causal link between obesity and probiotics. Nat Rev Microbiol 7(12):901–901

    Article  Google Scholar 

  42. Bloksma N, De Heer E, Van Dijk H, Willers JM (1979) Adjuvanticity of lactobacilli. I. Differential effects of viable and killed bacteria. Clin Exp Immunol 37(2):367

    Google Scholar 

  43. Bering S, Sjøltov L, Wrisberg SS, Berggren A, Alenfall J, Jensen M, Højgaard L, Tetens I, Bukhave K (2007) Viable, lyophilized lactobacilli do not increase iron absorption from a lactic acid-fermented meal in healthy young women, and no iron absorption occurs in the distal intestine. Br J Nutr 98(5):991–997

    Article  Google Scholar 

  44. FadL MG (2022) Characterization of genetic resources of microorganism as microorganism response of climate change. J Gene Engg Bio Res 4(2):165–172

    Google Scholar 

  45. Raccach M, Kovac SL, Meyer CM (1985) Susceptibility of meat lactic acid bacterla to antibiotics. Food Microbiol 2(4):271–275

    Article  Google Scholar 

  46. Donohue DC, Salminen S (1996) Safety of probiotic bacteria. Asia Pac J Clin Nutr 5:25–28

    Google Scholar 

  47. Donohue DC, Deighton M, Ahokas JT, Salminen S (1993) Toxicity of lactic acid bacteria. Lactic Acid Bact 9:307–313

  48. Mourad K, Nour-Eddine K (2006) In vitro preselection criteria for probiotic Lactobacillus plantarum strains of fermented olives origin. Int J Probiotics Prebiotics 1(1):27

    Google Scholar 

  49. Pot B, Coenye T, Kersters K (1997) The taxonomy of microorganisms used as probiotics with special focus on enterococci, lactococci, and lactobacilli. Microecol Ther 7:11–26

  50. Bassyouni RH, Abdel-all WS, Abdel-all MGFS, Kamel Z (2012) Characterization of lactic acid bacteria isolated from dairy products in Egypt as a probiotic

    Google Scholar 

  51. Preiss D, Sattar N (2008) Non-alcoholic fatty liver disease: an overview of prevalence, diagnosis, pathogenesis and treatment considerations. Clin Sci 115(5):141–150

    Article  Google Scholar 

  52. Devirgiliis C, Coppola D, Barile S, Colonna B, Perozzi G (2009) Characterization of the Tn 916 conjugative transposon in a food-borne strain of Lactobacillus paracasei. Appl Environ Microbiol 75(12):3866–3871

    Article  Google Scholar 

  53. AFRC, R.F (1989) Probiotics in man and animals. J Appl Bacteriol 66(5):365–378

    Article  Google Scholar 

  54. Batish VK, Ranganathan B (1986) Antibiotic susceptibility of deoxyribonuclease-positive enterococci isolated from milk and milk products and their epidemiological significance. Int J Food Microbiol 3(6):331–337

    Article  Google Scholar 

  55. Farahat MG (2020) Enhancement of β-cyclodextrin production and fabrication of edible antimicrobial films incorporated with clove essential oil/β-cyclodextrin inclusion complex. Microbiol Biotechnol Lett 48(1):12–23. https://doi.org/10.4014/mbl.1909.09016

    Article  Google Scholar 

  56. Gismondo MR, Drago L, Lombardi A (1999) Review of probiotics available to modify gastrointestinal flora. Int J Antimicrob Agents 12(4):287–292

    Article  Google Scholar 

  57. Kaur IP, Chopra K, Saini A (2002) Probiotics: potential pharmaceutical applications. Eur J Pharm Sci 15(1):1–9

    Article  Google Scholar 

Download references

Acknowledgements

The authors acknowledge Allah our God, My little Angles Mariam and Rahma, and finally my mother.

Funding

The authors are acknowledged for the funding.

Author information

Authors and Affiliations

  1. Nuclear Materials Authority, P.O. Box 530, El Maadi, Cairo, Egypt

    Mostafa G. Fadl

  2. Faculty of Science, Microbiology & Botany Department, Cairo University, Cairo, Egypt

    Zenat Kamel

Authors
  1. Mostafa G. Fadl
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Zenat Kamel
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

ZK supervised the planning. MGF is the coresponding author and helped in the designing, performing, and writing the experiment and result. All authors have read and approved the manuscript.

Corresponding author

Correspondence to Mostafa G. Fadl.

Ethics declarations

Ethics approval and consent to participate

Manuscript does not report studies involving human participants.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Fadl, M.G., Kamel, Z. Cholesterol-lowering effects and safety assessment of Lactobacillus spp. in vivo and in vitro testing for human use as probiotic from the dairy product in Egypt. J Genet Eng Biotechnol 20, 144 (2022). https://doi.org/10.1186/s43141-022-00423-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43141-022-00423-3

Keywords