Skip to main content

Immunity induced by valine-glycine repeat protein G imparts histoprotection of vital body organs against Acinetobacter baumannii

Abstract

Background

Efforts toward the development of an effective vaccine against Acinetobacter baumannii, one of the most notorious nosocomial pathogens, are still ongoing. In this regard, virulence factors are interesting targets. Type VI secretion system (T6SS) participates in the pathogenicity of A. baumannii. VgrG is a crucial component of T6SS prevalent among A. baumannii strains. This study was conducted to evaluate the immunoprotectivity of recombinant VgrG (rVgrG) cloned and over-expressed in Escherichia coli BL21 (DE3). BALB/c mice were immunized with the purified rVgrG. Specific anti-VgrG IgG titers were assessed by ELISA. Actively and passively immunized mice were challenged with lethal doses of A. baumannii ATCC 19606. The survival rate, the bacterial burden, and histopathology of tissues in infected mice were examined.

Results

Anti-VgrG IgG (p < 0.0001) was significantly increased in immunized mice. No death was seen in actively immunized mice infected with the lethal dose (LD) of 1.9 × 108 CFU of A. baumannii ATCC 19606 within 72 h. Challenge with 2.4 × 108 CFU of the pathogen showed a 75% survival rate. All immunized mice infected with 3.2 × 108 CFU of the pathogen died within 12 h. In passive immunization, no death was observed in mice that received LD of the bacteria incubated with the 1:250 dilution of the immune sera. An increased number of neutrophils around the peribronchial and perivascular areas were seen in unimmunized mouse lungs while passively immunized mice revealed moderate inflammation with infiltration of mixed mononuclear cells and neutrophils. The livers of the unimmunized mice showed inflammation and necrosis in contrast to the livers from immunized mice. Hyperplasia of the white pulp and higher neutrophils were evident in the spleen of unimmunized mice as against the normal histology of the immunized group.

Conclusions

VgrG is a protective antigen that could be topologically accessible to the host antibodies. Although VgrG is not sufficient to be assigned as a stand-alone antigen for conferring full protection, it could participate in multivalent vaccine developments for elevated efficacy.

Background

Acinetobacter baumannii, a successful nosocomial pathogen, is a serious health threat such that the Infectious Diseases Society of America (IDSA) assigned the pathogen as one of the six most dangerous microbes [1]. Moreover, based on World Health Organization (WHO) ranking, this is the 1st pathogen that urgently needs new antibiotics. However, no effective approved antibiotic is introduced against drug-resistant strains of A. baumannii. Hence, active and passive immunizations could be invoked as an alternative solution against the notorious pathogen. Several studies nominated promising immunogens for active and passive immunizations against A. baumannii [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19]. However, none has been investigated in clinical trials. Animal studies have revealed that perfect protection could not be achieved by the administration of a single antigen. In this regard, investigations about A. baumannii antigens are still ongoing. Virulence factors are among the most attractive targets for immunization against pathogens. Secretion systems have pivotal roles in the pathogenicity of bacteria. Type VI secretion system (T6SS), a weapon in many Gram-negative bacteria, is responsible for delivering many toxic protein effectors into prokaryotic and eukaryotic prey cells [20]. This apparatus comprised at least 13 conserved proteins consisting of a baseplate, a membrane-spanning structure, a contractile sheath, a cytoplasmic sheath recycling protein, and an injectable needle. However, various bacteria could produce their accessory proteins and secretory effectors. The hemolysin co-regulated protein (Hcp), the proline-alanine-alanine-arginine repeat (PAAR) protein, and a trimer of valine-glycine-arginine G (VgrG) are involved in the formation of the injectable needle in which Hcp hexamers are from the main tube. The tube is capped with VgrG and, in some cases, the PAAR protein [20]. T6SS has also been identified in many strains of A. baumannii [21]. However, as a difference, it has no homolog for a conserved outer membrane lipoprotein, TssJ, of Escherichia coli [21]. Previous studies unveiled that, among components of T6SS, VgrG is an appropriate candidate for the investigation of active and passive immunizations. This protein increases A. baumannii virulence and its adhesion to lung epithelial cells [22]. In silico analyses revealed that VgrG is present in most A. baumannii strains [23, 24]; T6SS-positive strains usually harbor 2–4 copies of the vgrG gene [23]. The C terminus of this crucial structural component of T6SS is essential for the functional assembly of T6SS nanomachine in A. baumannii [25]. Hence, VgrG is an impressive virulence factor to be explored with immunization. Recently, we studied the VgrG421-765 and VgrG421-536 regions regarding immunoprotective effects. Challenge with a lethal dose of A. baumannii ATCC 19606 in mice immunized with VgrG421-765 and VgrG421-536 showed 33% and 66% survival rates, respectively [2]. Surprisingly, VgrG421-536 developed higher protectivity; however, none of the selected regions conferred full protection against a lethal dose of the bacteria. Although immunoprotective effects of the selected regions were elucidated, protective effects of VgrG encompassing both N- and C-terminal domains remained to be addressed. The current study is conducted to evaluate the immunoprotective efficacy of the recombinant VgrG in a murine model.

Methods

Overexpression of VgrG

In the current study, genomic DNA of A. baumannii ATCC 19606 was used as a source of the vgrG gene. A pair of primers (forward: CAAGGATCCATGGTATTCTTACAACGTATAGAAGGCCAACATC and reverse: CCGTCTAGATTACATACATTCTTGCTCCATCTTGAGCTGCAA) was designed to amplify the vgrG gene by polymerase chain reaction (PCR). The primers were harboring restriction sites of BamHI and XbaI enzymes (underlined). The PCR product and the expression plasmid (e5044) were digested with BamHI and XbaI. The digested amplicon was ligated to the plasmid and transformed to competent cells of Escherichia coli BL21 (DE3) strain. The transformants were grown overnight at 37 °C in an auto-induction medium [26] supplemented with 100 μg/mL ampicillin. The cells were harvested by centrifugation and resuspended in denaturing buffer (8 M urea, 10 mM Tris-HCl, 100 mM NaH2PO4, pH 8). The cell suspension was sonicated and then was centrifuged at 13000 rpm, for 20 min at 4 °C. The supernatant was used for the purification procedure. The recombinant protein was purified in denaturing conditions by the Ni-NTA affinity column (Qiagen, Germany). The purified protein was analyzed by 9% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The denatured protein was refolded by sequential dialysis against PBS containing 6, 4, 2, and 0 M urea + 0.5 mM l-arginine (pH 7.4) at 4 °C for 2 h. Bradford protein assay [27] was used to estimate the concentration of the purified recombinant protein.

Mouse immunization

Twenty-four 6- to 8-week-old female BALB/c mice weighing 20–25 g were distributed into two groups of 12 mice each in the control group and the test groups. In the first injection, the test group received subcutaneously 20 μg of the purified recombinant protein mixed with 1:1 (v/v) ratio of complete Freund’s adjuvant (Sigma-Aldrich, Merck KGaA, Germany). Boosters were administered on days 15 and 30 with 20 μg of the refolded recombinant protein admixed with incomplete Freund’s adjuvant (Sigma-Aldrich) at a 1:1 (v/v) ratio. The control group received PBS mixed with 0.5 mg arginine and emulsified with a 1:1 (v/v) ratio of the adjuvants. The mice received 100 μL of the prepared mixture in each injection. Blood samples of mice were collected on days 14, 29, and 44. The sera were separated and stored at 20 °C.

Enzyme-linked immunosorbent assay (ELISA)

Anti-VgrG-specific IgGs in the sera collected from the immunized mice were assessed by indirect ELISA. Briefly, the recombinant VgrG (2 μg/well) was coated in a 96-well ELISA plate. After incubation (overnight at 4 °C), the wells were washed three times with PBST (PBS containing 0.05% Tween 20), and then 100 μL of blocking solution (5% skimmed milk in PBST) was added to the wells. The plate was incubated at 37 °C for 1 h followed by washing (3 times with PBST), after which 100 μL of serially diluted (1:250 to 1:64000) sera was added to the wells. The plate was incubated at 37 °C for 2 h, and then the washing step was repeated. A secondary antibody (horseradish peroxidase-conjugated antibody), diluted to 1:15000 in PBST, was added (100 μL/well). The plate was incubated at 37 °C for 1 h followed by a washing step. Then, 3,3-5,5-tetramethylbenzidine (TMB) solution was added as a substrate (100 μL/well) to develop color. The reaction was stopped by the addition of 3 M H2SO4, and the absorbance was read at 450 nm using an ELISA reader. The endpoint titer was defined as the highest dilution at which the optical density was 0.1 greater than that of control wells receiving control adjuvant serum.

Western blotting

The recombinant protein expression was validated by Western blotting with horseradish peroxidase (HRP)-conjugated anti-polyhistidine antibodies (1:10,000 dilution) in which 0.5 μg of the recombinant protein was loaded onto the SDS-PAGE. The recombinant protein was separated on 9% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto a nitrocellulose membrane using transfer buffer (150 mM glycine, 20 mM Tris-base, and 20% methanol). The membrane was blocked with 5% skim milk in PBST at 4 °C overnight. The membrane was incubated with pooled antiserum samples at a dilution of 1:2000 for 2 h and then incubated with a horseradish peroxidase secondary antibody at a 1:10,000 dilution with gentle shaking for 2 h at room temperature. The membrane was washed three times with PBST, and the immunoblot was developed using 3,3-diaminobenzidine (Sigma).

Bacterial challenges

Actively immunized mouse group

A. baumannii ATCC 19606 was employed for challenges with viable bacteria in mice. The lethal dose of A. baumannii ATCC 19606 was determined. The control and actively immunized mouse groups received intraperitoneally 1.9 × 108 CFU, 2.4 × 108 CFU, and 3.2 × 108 CFU of A. baumannii ATCC 19606. The mouse survival was monitored for 72 h. The survived mice were sacrificed, and their spleens and lungs were removed aseptically. The organs were weighed and homogenized in sterile normal saline. The mixtures were serially diluted and plated on LB agar. The plates were incubated overnight at 37 °C.

Passive immunization and histopathology

In passive immunization, inocula for each mouse were prepared as follows: after inactivation of the complement system, the sera (1:250 dilutions) obtained from immune or non-immune mice were incubated with 1.9 × 108 CFU of A. baumannii ATCC 19606. The suspensions were incubated in a shaking incubator at 37 °C for 2 h. The bacteria were harvested by centrifugation and re-suspended in 100 μL sterile PBS. The suspensions were intraperitoneally injected into the mice. The mouse survival was monitored for 72 h followed by scarification of the survivals. Their liver, spleen, and lungs were aseptically removed and processed for a histopathology examination. The biopsies were fixed in 10% buffered formalin followed by staining with hematoxylin-eosin. The histopathological changes were observed under a light microscope.

Statistical analyses

Statistical analyses were performed using the GraphPad Prism 8.0 software. The data were presented as mean with standard deviations represented as error bars. Comparison of antibody titers was performed using a Kruskal-Wallis test followed by Dunn’s multiple comparison test. The bacterial burdens were compared with an unpaired Student’s t-test. Survival was compared using the non-parametric log-rank test. Differences were considered significant if the p-value was < 0.05.

Results

Recombinant VgrG expression and purification

The vgrG gene was successfully amplified by PCR from the A. baumannii ATCC 19606 genome. The cloned gene into the e5044 plasmid was confirmed via sequencing. The purified recombinant VgrG expressed in E. coli BL21 (DE3) revealed a band with an apparent molecular weight of approximately 126 kDa on 9% SDS-PAGE and confirmed by Western blot analysis (Fig. S1).

Anti-VgrG immunoglobulin G (IgG)

ELISA data (Fig. 1) indicated that the levels of IgG raised to VgrG increased significantly after the second immunization (mean value = 18000) (p <0.01). Antibody titers were higher after the third immunization with a mean value of 32,000; the difference was significant compared to the control group (p < 0.001).

Fig. 1
figure 1

IgG titers determined by indirect ELISA against the recombinant VgrG. The endpoint titer was defined as the highest dilution at which the optical density was 0.1 greater than that of the control wells receiving control adjuvant serum. Comparisons between the groups were performed using a Kruskal-Wallis test followed by Dunn’s multiple comparison test (**p < 01, ***p < 001)

Active immunization

LD50 and LD of A. baumannii ATCC 19606 were determined as 1.3 × 108 CFU and 1.9 × 108 CFU, respectively. All control mice that received 1.9 × 108 CFU (LD), 2.4 × 108 CFU, and 3.2 × 108 CFU of A. baumannii ATCC 19606 died within 12 h. No death was seen in the test group challenged with the lethal dose of A. baumannii ATCC 19606. In the test group that received 2.4 × 108 CFU of A. baumannii ATCC 19606, 75% of mice survived within 72 h (Fig. 2). All the immunized mice that received 3.2 × 108 CFU of A. baumannii ATCC 19606 died within 12 h (Fig. 2). Immunization with the recombinant VgrG significantly (p < 0.001) reduced the bacterial burden in the lung and spleen by approximately 4–5 log cycles 12 h postinfection as compared to adjuvant control (Fig. 3).

Fig. 2
figure 2

The survival rate in actively immunized mice. The non-parametric log-rank test was used for the analyses of survival rates (p < 0.001)

Fig. 3
figure 3

Bacterial burden in the lungs and spleens of the control and actively immunized mouse groups

Passive immunization

In passive immunization, 1.9 × 108 CFU of A. baumannii ATCC 19606 incubated with the sera (1:250 dilutions) obtained from immune or non-immune mice was used as inoculums for each mouse. All control mice died within 12 h while no death was seen in the test group within 72 h (Fig. 4).

Fig. 4
figure 4

The mouse survival rate in passive immunization. The non-parametric log-rank test was used for the analyses of survival rates (p < 0.001)

Histopathology

Histopathological examinations showed that bacterial challenge caused an increasing number of neutrophils around the peribronchial and perivascular areas in unimmunized mice while immunized mice revealed moderate inflammation with infiltration of mixed mononuclear cells and neutrophils (Fig. 5). Passive immunization with anti-VgrG sera reduced liver pathology following challenge with the pathogen. The livers of unimmunized mice show inflammation and necrosis. In contrast, the livers from immunized mice showed no significant histopathologic changes (Fig. 5). The spleen of unimmunized mice showed hyperplasia of the white pulp and higher neutrophils (Fig. 5).

Fig. 5
figure 5

Histopathological examinations of the lung (A1, A2), liver (B1, B2), and spleen (C1, C2) in unimmunized and passively immunized mice challenged with A. baumannii. The bacterial challenge caused an increasing number of neutrophils around the peribronchial and perivascular areas in unimmunized mouse lungs (A1) while immunized mice revealed moderate inflammation with infiltration of mixed mononuclear cells and neutrophils (A2). The livers of unimmunized mice show inflammation and necrosis (B1). In contrast, the livers from immunized mice showed no significant pathology (B2). The spleen of unimmunized mice showed hyperplasia of the white pulp and higher neutrophils (C1) as against the normal structure retained in the immunized group (C2)

Discussion

Secretion systems play pivotal roles in the pathogenicity of bacteria. VgrG is a component of T6SS that could increase A. baumannii virulence and its adhesion to lung epithelial cells [22]. This virulence factor is present in most A. baumannii strains [23, 24]. VgrG is located at the tip of the injectable needle of T6SS; hence, it could be exposed to host antibodies. The recombinant protein encompassing both N- and C-terminal domains include most of the potential epitopes. In our recent study, mice immunized with VgrG421-765 showed a 33% survival rate in a challenge with LD of A. baumannii ATCC 19606 [2]. In the present study, overexpression of the recombinant VgrG resulted in the formation of inclusion bodies. So, the protein was purified in denaturing conditions. The purified VgrG was aggregated during dialysis against PBS buffer. Hence, l-arginine was added to prevent aggregate formation [5]. Full protection was observed in the immunized mice against a lethal dose of A. baumannii demonstrating that the N terminus of VgrG contains important epitopes which could elevate the immunoprotective efficacy of VgrG. The conferred protection revealed that VgrG is expressed by the pathogen in the murine sepsis model. Since T6SS is energetically costly, many T6SS-positive strains tightly regulate its expression at various levels. In A. baumannii, some strains have a constitutively active T6SS which also express under standard laboratory conditions; some strains possess a silenced T6SS transcriptionally repressed by large conjugative plasmids (LCPs) of multidrug-resistance; the last strains are those regulating their T6SS by unknown mechanisms [25]. The immunoprotective efficacy of vaccination could be affected by the expression level of VgrG at the infection condition. Some antigens are associated with specific infection types of A. baumannii [28]. In contrast, some antigens are associated with different infection types [28]. Immunization with VacJ, a 299 amino acid lipoprotein, showed no significant protection against LD50 of A. baumannii ATCC 19606 in a murine sepsis model. However, in a murine pneumonia model, immunized mice showed a 600-fold reduction of the bacterial load in the lungs [29]. Protectivity levels of various antigens vary from one antigen to the other. rBauA could confer full protection against 100× LD50 of A. baumannii ATCC 19606 in actively immunized mice [30]. Mice actively immunized with Bap had shown full protection against 100× LD50 of a clinical strain of A. baumannii [31]. The survival rate of Bap-immunized mice challenged with 105× LD50 of the clinical strain was 60% [31]. Mice immunized with FimA had revealed full protection against 10× LD50 of A. baumannii ATCC 19606 [32]. The present study demonstrated that VgrG could not develop full protection against more than minimal lethal doses of A. baumannii ATCC 19606. This dose is < 2× LD50 of the pathogen. Administration dose of the antigen is an important criterion in immune responses and immunoprotective efficacy. It has been shown that, in a sepsis model, immunization of mice with 50 μg and 20 μg of Omp22 could provide 100% and 33% survival against a lethal dose of a clinical strain, respectively [1]. In our previous study, mice who received 40 μg of VacJ showed higher titers of specific antibodies in comparison with mice who received 20 μg of the antigen such that in mice received 40 μg of VacJ, 3 injections were sufficient to trigger high titer of anti-VacJ antibodies [29]. Although only the dose of 20 μg VgrG was investigated in the present study, it would be expected that higher administration doses could increase immune responses and immunoprotective efficacy. Since VgrG is located at the tip of T6SS, it is highly accessible to host antibodies. It has been demonstrated that anti-OmpA monoclonal antibodies (MAbs) could not confer protection against encapsulated strains of A. baumannii, in a murine sepsis model, owing to shielding of OmpA by capsule polysaccharide which could inhibit binding of anti-OmpA MAbs to the bacteria [33]. Anti-VgrG antibodies could overcome this obstacle because VgrG is topologically more accessible than OmpA.

Conclusion

VgrG is found to be a protective antigen to take a part in vaccine developments. This antigen could be topologically accessible to host antibodies even in encapsulated strains of A. baumannii. However, some considerations such as species specificity need to be considered.

Availability of data and materials

The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Huang W, Yao Y, Wang S, Xia Y, Yang X, Long Q, Sun W, Liu C, Li Y, Chu X (2016) Immunization with a 22-kDa outer membrane protein elicits protective immunity to multidrug-resistant Acinetobacter baumannii. Sci Rep 6:20724

    Article  Google Scholar 

  2. Pazoki M, Astaneh SDA, Ramezanalizadeh F, Jahangiri A, Rasooli I (2021) Immunoprotectivity of valine–glycine repeat protein G, a potent mediator of pathogenicity, against Acinetobacter baumannii. Mol Immunol 135:276–284

    Article  Google Scholar 

  3. Jahangiri A, Owlia P, Rasooli I, Salimian J, Derakhshanifar E, Aghajani Z, Abdollahi S, Khalili S, Talei D, Eslam ED (2021) Specific egg yolk immunoglobulin as a promising non-antibiotic biotherapeutic product against Acinetobacter baumannii pneumonia infection. Sci Rep 11(1):1–11

    Article  Google Scholar 

  4. Rasooli I, Abdolhamidi R, Jahangiri A, Astaneh SDA (2020) Outer membrane protein, Oma87 prevents Acinetobacter baumannii infection. Int J Pept Res Ther March 9:1–8

  5. Mahmoudi Z, Rasooli I, Jahangiri A, Darvish Alipour Astaneh S (2020) Prevention of nosocomial Acinetobacter baumannii infections with a conserved immunogenic fimbrial protein. APMIS

  6. Eslam ED, Astaneh SDA, Rasooli I, Nazarian S, Jahangiri A (2020) Passive immunization with chitosan-loaded biofilm-associated protein against Acinetobacter baumannii murine infection model. Gene Rep 20 September:100708

  7. Jahangiri A, Owlia P, Rasooli I, Salimian J, Derakhshanifar E, Naghipour Erami A, Darzi Eslam E, Darvish Alipour Astaneh S (2019) Specific egg yolk antibodies (IgY) confer protection against Acinetobacter baumannii in a murine pneumonia model. J Appl Microbiol 126(2):624–632

    Article  Google Scholar 

  8. Bazmara H, Rasooli I, Jahangiri A, Sefid F, Astaneh SDA, Payandeh Z (2019) Antigenic properties of iron regulated proteins in Acinetobacter baumannii: an in silico approach. Int J Pept Res Ther 25(1):205–213

    Article  Google Scholar 

  9. Jahangiri A, Rasooli I, Owlia P, Imani Fooladi AA, Salimian J (2018) Highly conserved exposed immunogenic peptides of Omp34 against Acinetobacter baumannii: an innovative approach. J Microbiol Methods 144(Supplement C):79–85. https://doi.org/10.1016/j.mimet.2017.11.008

    Article  Google Scholar 

  10. Jahangiri A, Rasooli I, Owlia P, Fooladi AAI, Salimian J (2017) In silico design of an immunogen against Acinetobacter baumannii based on a novel model for native structure of outer membrane protein A. Microb Pathog 105:201–210

    Article  Google Scholar 

  11. Singh R, Garg N, Shukla G, Capalash N, Sharma P (2016) Immunoprotective efficacy of Acinetobacter baumannii outer membrane protein, FilF, predicted in silico as a potential vaccine candidate. Front Microbiol 7(158). https://doi.org/10.3389/fmicb.2016.00158

  12. Garg N, Singh R, Shukla G, Capalash N, Sharma P (2016) Immunoprotective potential of in silico predicted Acinetobacter baumannii outer membrane nuclease, NucAb. Int J Med Microbiol 306(1):1–9. https://doi.org/10.1016/j.ijmm.2015.10.005

    Article  Google Scholar 

  13. Sefid F, Rasooli I, Jahangiri A, Bazmara H (2015) Functional exposed amino acids of BauA as potential immunogen against Acinetobacter baumannii. Acta Biotheor 63(2):129-49. https://doi.org/10.1007/s10441-015-9251-2

  14. KuoLee R, Harris G, Yan H, Xu HH, Conlan WJ, Patel GB, Chen W (2015) Intranasal immunization protects against Acinetobacter baumannii-associated pneumonia in mice. Vaccine 33(1):260–267

    Article  Google Scholar 

  15. Huang W, Wang S, Yao Y, Xia Y, Yang X, Long Q, Sun W, Liu C, Li Y, Ma Y (2015) OmpW is a potential target for eliciting protective immunity against Acinetobacter baumannii infections. Vaccine 33(36):4479–4485

    Article  Google Scholar 

  16. Badmasti F, Ajdary S, Bouzari S, Fooladi AAI, Shahcheraghi F, Siadat SD (2015) Immunological evaluation of OMV (PagL)+ Bap (1-487aa) and AbOmpA (8-346aa)+ Bap (1-487aa) as vaccine candidates against Acinetobacter baumannii sepsis infection. Mol Immunol 67(2):552–558

    Article  Google Scholar 

  17. Hosseingholi EZ, Rasooli I, Gargari SLM (2014) In silico analysis of Acinetobacter baumannii phospholipase D as a subunit vaccine candidate. Acta Biotheor 62(4):455–478

    Article  Google Scholar 

  18. Lin L, Tan B, Pantapalangkoor P, Ho T, Hujer AM, Taracila MA, Bonomo RA, Spellberg B (2013) Acinetobacter baumannii rOmpA vaccine dose alters immune polarization and immunodominant epitopes. Vaccine 31(2):313–318

    Article  Google Scholar 

  19. Luo G, Lin L, Ibrahim AS, Baquir B, Pantapalangkoor P, Bonomo RA, Doi Y, Adams MD, Russo TA, Spellberg B (2012) Active and passive immunization protects against lethal, extreme drug resistant-Acinetobacter baumannii infection. PLoS One 7(1):e29446

    Article  Google Scholar 

  20. Cianfanelli FR, Monlezun L, Coulthurst SJ (2016) Aim, load, fire: the type VI secretion system, a bacterial nanoweapon. Trends Microbiol 24(1):51–62

    Article  Google Scholar 

  21. Carruthers MD, Nicholson PA, Tracy EN, Munson RS Jr (2013) Acinetobacter baumannii utilizes a type VI secretion system for bacterial competition. PLoS One 8(3):e59388

    Article  Google Scholar 

  22. Wang J, Zhou Z, He F, Ruan Z, Jiang Y, Hua X, Yu Y (2018) The role of the type VI secretion system vgrG gene in the virulence and antimicrobial resistance of Acinetobacter baumannii ATCC 19606. PLoS One 13(2):e0192288

    Article  Google Scholar 

  23. Repizo GD, Espariz M, Seravalle JL, Salcedo SP (2019) Bioinformatic analysis of the type VI secretion system and its potential toxins in the Acinetobacter genus. Front Microbiol 10:2519

    Article  Google Scholar 

  24. Lewis JM, Deveson Lucas D, Harper M, Boyce JD (2019) Systematic identification and analysis of Acinetobacter baumannii type VI secretion system effector and immunity components. Front Microbiol 10:2440

    Article  Google Scholar 

  25. Lopez J, Ly PM, Feldman MF (2020) The tip of the VgrG spike is essential to functional type VI secretion system assembly in Acinetobacter baumannii. MBio 11(1): e02761-19. https://doi.org/10.1128/mBio.02761-19

  26. Studier FW (2005) Protein production by auto-induction in high-density shaking cultures. Protein Expr Purif 41(1):207–234

    Article  Google Scholar 

  27. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1-2):248–254

    Article  Google Scholar 

  28. McConnell MJ, Martín-Galiano AJ (2021) Designing multi-antigen vaccines against Acinetobacter baumannii using systemic approaches. Front Immunol 12:1223

    Article  Google Scholar 

  29. Masoumkhani S, Alipour Astaneh SD, Jahangiri A, Rasooli I (2020) Virulence-associated chromosome locus J, VacJ, an outer membrane lipoprotein elicits protective immunity against Acinetobacter baumannii infection in mice. Trends Med 20. https://doi.org/10.15761/TiM.1000236

  30. Esmaeilkhani H, Rasooli I, Nazarian S, Sefid F (2016) In vivo validation of the immunogenicity of recombinant baumannii acinetobactin utilization a protein (rBauA). Microb Pathog 98:77–81

    Article  Google Scholar 

  31. Fattahian Y, Rasooli I, Gargari SLM, Rahbar MR, Astaneh SDA, Amani J (2011) Protection against Acinetobacter baumannii infection via its functional deprivation of biofilm associated protein (Bap). Microb Pathog 51(6):402–406

    Article  Google Scholar 

  32. Ramezanalizadeh F, Owlia P, Rasooli I (2020) Type I pili, CsuA/B and FimA induce a protective immune response against Acinetobacter baumannii. Vaccine 38(34):5436–5446

    Article  Google Scholar 

  33. Wang-Lin SX, Olson R, Beanan JM, MacDonald U, Balthasar JP, Russo TA (2017) The capsular polysaccharide of Acinetobacter baumannii is an obstacle for therapeutic passive immunization strategies. Infect Immun 85(12):e00591-17. https://doi.org/10.1128/IAI.00591-17

Download references

Acknowledgements

The authors wish to thank the Molecular Microbiology Research Center of Shahed University for the use of its research laboratory to conduct this project.

Funding

This research was funded by the Molecular Microbiology Research Center of Shahed University (Grant number 1303747).

Author information

Authors and Affiliations

Authors

Contributions

SA performed all the experiments and manuscript writing. IR conceptualized the study, overall guidance, and manuscript writing. MHG carried out the pathological studies. AJ designed the experiments and supervised SA. SDAA designed and supervised the immunological experiments. FR performed the statistical analyses and drew the graphs. All authors were involved in the preparation of the manuscript. The authors read and approved the final manuscript.

Corresponding author

Correspondence to Iraj Rasooli.

Ethics declarations

Ethics approval and consent to participate

The research was conducted in compliance with the principles stated in the Guide for the Care and Use of Laboratory Animals. The protocol regarding animal care was approved by the ethics committee of Shahed University. We certify that the study was performed following the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Figure S1

. Expression (a) and western blotting (b) of the recombinant VgrG. a. Expression of recombinant VgrG. The supernatant of the lysed cells in denaturing buffer (buffer B) showing expression of the  ̴ 126 kDa recombinant VgrG. b. Confirmation of the recombinant VgrG by Western blotting.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Alipouri, S., Rasooli, I., Ghaini, M.H. et al. Immunity induced by valine-glycine repeat protein G imparts histoprotection of vital body organs against Acinetobacter baumannii. J Genet Eng Biotechnol 20, 42 (2022). https://doi.org/10.1186/s43141-022-00325-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43141-022-00325-4

Keywords