Skip to main content

Development of partial abiotic stress tolerant Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck through Agrobacterium-mediated transformation method

Abstract

Background

Recent studies indicate that farmers are facing several challenges due to biotic and abiotic stresses like diseases, drought, cold, and soil salinity which are causing declined Citrus production. Thus, it is essential to improve these varieties which would be resistant against biotic and abiotic stresses as well as high yielding. The transformation of abiotic stress tolerant genes in Citrus species is essential for using areas affected by abiotic stresses. This study was aimed to improve resistance of Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck to abiotic stresses by transferring PsCBL and PsCIPK genes through Agrobacterium-mediated transformation.

Results

Abiotic stress tolerant PsCBL and PsCIPK genes isolated from Pisum sativum were transformed into two Citrus species, Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck, through Agrobacterium-mediated transformation method. Mature seed-derived calli of two Species were infected with Agrobacterium tumefaciens LBA4404 harboring PsCBL and PsCIPK genes. The infected calli were co-cultured in dark condition and later on washed with antibiotic solution and transferred to selection medium. Preliminary resistant calli were recovered and regenerated to plantlets. Maximum regeneration rate was 61.11 ± 1.35% and 55.55 ± 1.03%, respectively. The genetic transformation was confirmed by performing β glucuronidase (GUS) assays and subsequent PCR amplification of the GUS gene. The transformation rates of the two cultivated species were higher than previous reports. Maximum transformation frequencies were found when bacterial OD600 was 0.5 and concentration of acetosyringone was 150 μM. In-vitro evaluation of drought and salt tolerance of transgenic plantlets were done, and transgenic plantlets showed better performance than the control plants.

Conclusions

The present study demonstrates that transformation of Citrus plants with PsCBL and PsCIPK genes result in improved abiotic stress tolerance.

Background

The genus Citrus includes more than 162 species belonging to the order Geraniales, family Rutaceae and subfamily Aurantoideae. Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck are two primitive species of Citrus. Citrus sinensis also known as Sweet-orange or Malta, is the most cultivated Citrus in the world which accounts for about 70% of the total production. Citrus reticulata Blanco is a species of Citrus also known as Mandarin, Tangerine, Unshu orange, Comola etc in the Asian Subcontinent. Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck, both are grown in tropical and semi-tropical areas around the globe for its sweet, juicy, and nutritious fruits. Orange farming has been extending rapidly in some regions of Bangladesh like Sylhet, Panchagarh, Chattogram, and Thakurgaon. Recent studies indicate that farmers are facing several problems due to biotic and abiotic stresses like diseases, drought, cold, and soil salinity which are causing declined Citrus production. Thus, it is essential to improve these varieties which would be resistant against biotic and abiotic stresses and would be high yielding. Traditional breeding methods have been used successfully over the years to improve Citrus; however, these methods are limited by slow growth, incompatibility, polyembryony, parthenocarpy etc and traditional breeding takes a long time for the incorporation of desirable traits. In-vitro culture made it easy to improve Citrus against different abiotic stresses, diseases, low-yield through exploiting somaclonal variations, somatic cell hybridization [1, 2], transformation of high yielding cultivars [3] and also to conserve important Citrus genotypes. In plants, the Ca2+ is involved in almost all biological processes. Calcium serves as a ubiquitous secondary messenger and regulates a multitude of physiological and developmental processes, including responses to abiotic stress, pathogen defense, and adjustment of ion homeostasis [4,5,6]. In response to environmental and developmental stimuli, plant cells react with specific temporal changes in cytosolic calcium (Ca2+) concentration. Ca2+ can serve simultaneously as a messenger and a regulator in so many different processes, that it raises the fundamental question of how specificity in information processing and output determination can be achieved [7,8,9]. The families of calcineurin B-like (CBL) proteins represent a unique group of calcium sensors and contribute to the decoding of calcium transients by interacting with and regulating the family of CBL-interacting protein kinases (CIPKs). In higher plants, CBL proteins and CIPKs form a complex signaling network that allows for flexible but specific signal response coupling during environmental adaptation reactions [10]. The CBL-CIPK network helps to maintain proper ion balance when abiotic stresses occur. The CBL and CIPK homolog are present in all green lineages, and phylogenomic analysis suggests their expansion from a single CBL-CIPK pair present in the ancestor of modern plants and algae [10]. Thus, the incorporation of these two key genes into the desired plants would improve the resistance against abiotic stresses. This study was aimed to develop resistance of Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck to abiotic stresses by transferring PsCBL and PsCIPK genes through Agrobacterium-mediated transformation.

Methods

Plant materials and media

Orange species Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck was collected from Citrus Research Station, Jaintapur, Sylhet, Bangladesh, and identification and confirmation of collected samples were done by J.C. Sarker, Senior Scientific Officer, Citrus Research Station, Jaintapur, Sylhet , Bangladesh. The healthy and good quality mature seeds from these orange cultivars were collected. Dehusked mature seeds were sterilized with 70% ethanol for 5 mins, 0.1% HgCl2 and Tween 20 for 2 mins, followed by washing with autoclaved distilled water and then dried on sterilized filter paper. The culture medium used in this study was based on MS [11] basal salts and vitamins (Table 1). All plant samples handled in this experiment were maintained in specific culture room to avoid any direct contact with environment, and all the used chemicals and plant materials were discared following bio-safety guideline provided by institute. 

Table 1 The composition of different media used in this transformation study

Agrobacterium strains and culture conditions

The transformation studies were carried out with Agrobacterium tumefaciens LBA4404 harboring the binary vector pBI121/PsCBL and pBI121/PsCIPK containing abiotic stress tolerant PsCBL and PsCIPK genes, respectively, uidA gene encoding β-glucuronidase (GUS) and nptII gene encoding neomycin phosphotransferase II conferring kanamycin resistance [12,13,14]. The single colonies of both strains were cultured in liquid YEP medium containing 100 mg/l kanamycin and grown in a shaker at 200 rpm in dark at 28 °C for 48 h until the OD600 reached between 0.4 and 0.8. The bacterial cells were collected with centrifugation at 8000 rpm for 5 mins and suspended in MS resuspension medium in an appropriate ratio to adjust OD600 to 0.5 and then different concentrations of acetosyringone (100, 150, and 200 μM) were added.

Callus induction

The sterilized seeds were inoculated in test tube on MS medium containing 2,4-D at different concentrations (0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 5.0 mg/l) and incubated at 25 ± 1 °C in 2000 lx light. Fifty seeds were inoculated per replication, and experiments were repeated three times. After 3 weeks only yellowish white colored globular calli were selected and cut into small pieces and subcultured onto fresh callus induction medium (Table 1) for infection with Agrobacterium.

Infection with Agrobacterium and co-culture

Fresh calli were taken from previous experiment and subjected to infection by immersing them in the infection medium containing the LBA4404 strain having pBI121/PsCBL sense vector and LBA4404 strain having pBI121/PsCIPK sense vector for 90 mins with intermittent gentle shaking and dried on sterile filter paper for 30 mins. The infected calli were cultured on co-cultivation medium (Table 1) for 3 days in dark conditions at 25 °C ± 1 °C. The co-cultivation medium was fortified with 0, 100, 150, and 200 μM acetosyringone to determine the optimum concentration of acetosyringone to increase the transformation efficiency.

Washing and inoculation in selection medium

After the appearance of slight growth of Agrobacterium around most of the calli were rinsed 8–10 times in sterile distilled water. Followed by washing with sterile distilled water, the calli were washed with the washing solution containing cefotaxime (500, 600, 700, and 800 mg/l) for 5 mins. The antibiotic treated calli were washed with sterile distilled water and dried on sterile filter paper. Then, the calli were transferred onto the selection medium and incubated for 15 days at 25 ± 1 °C in dark. After that, the calli were again sub-cultured on the selection media (Table 1) for 7 days and incubated in 25 ± 1 °C in dark.

Regeneration of putative transformants and In-vitro evaluation

Fresh and growing calli from the second selection medium were transferred to regeneration medium containing different concentrations and combinations of BA and NAA and were incubated at 25 ± 1 °C in white fluorescent light under 16-h photoperiods and sub-cultured on the same media after 14 days. Shoot proliferation started after 3 weeks and the regenerated shoots were shifted to the rooting media and were maintained at 25 ± 1 °C in white fluorescent light under 16-h photoperiods. In-vitro evaluation of kanamycin resistant-regenerated plantlets was done in MS medium supplemented with different concentrations of NaCl (50, 100, 150, and 200 mM) and 3 mg/l PEG. Tolerant plants were maintained under controlled conditions by sub-culturing at an interval of 21 days regularly.

GUS histochemical assay of transformed callus

GUS activity was detected as described by Jefferson et al. (1987). Randomly kanamycin-resistant calli of two Citrus species were taken from selection medium and washed with autoclaved distilled water to remove adjacent media. The calli were incubated in X-glucuronide (5-bromo-4-chloro-indoyl β-D glucuronide) staining solution at 37 °C for 24 h in dark. The X-glucuronide was broken down by the activity of β-glucuronidase (GUS) gene, which was transferred to the cells of calli by Agrobacterium tumefaciens. The stained tissues were rinsed several times with 75% ethanol. Calli stained with indigogenic dye were scored, and stable GUS expression was tested in kanamycin-resistant calli. The transformation efficiency was calculated by percent of GUS-positive calli.

PCR analysis of transformed regenerated plantlets

The genomic DNA of kanamycin-resistant regenerated plantlets (putative) and control plants of two Citrus species were extracted from the leaves by using the modified CTAB method [15]. The 600 bp fragments of the GUS gene were amplified using the following set of primer: Forward 5´TTTGCAAGTGGTGAATCCCGACCT-3´ and Reverse 5´AGTTTACGCGTTGCTTCCGCC AGT-3´ [16]. The PCR reaction was carried out in 25-μl mixture containing 2.5 μl 10X Taq buffer, 1.5 μl 25 mM MgCl2 , 1.0 μl dNTPs mix, 6.25 μl 2 μM Forward primer, 6.25 μl 2 μM Reverse primer, 0.2 μl Taq DNA polymerase (5U/μl), 2.3 μl Sterile ddH2O and 5.0 μl Template DNA. The PCR reaction conditions were initial denaturation at 95 °C for 5 mins, 35 cycles of denaturation at 95 °C for 1 min, annealing at 54 °C for 1 min, extension at 72 °C for 2 mins, and the final extension at 72 °C for 10 mins. The PCR products were confirmed by running in 1.4% agarose gel ectrophoresis in 1X TBE buffer. 2.0 μl loading dye was mixed with PCR products and loaded in the wells. A marker DNA (1 Kb Sharp DNA Ladder Marker, RBC Bioscience Corporation) was also loaded on one side of the gel and electrophoresis was conducted at 75 V for 50 mins. After completion of electrophoresis, the gel was stained in ethidium bromide for 2 h and placed on UV transilluminator in Gel Documentation System. Finally, the photograph was captured (Nikon D5300).

Statistical analysis

All the experimental data were collected at regular intervals for analysis and reckoned under statistical basis. Arithmetic mean (A.M.) and standard deviation (S.D.) were calculated by analyzing the data with Microsoft Excel 2007. Standard error (S.E.) was calculated by dividing standard deviation by square root of the total three replications for a single variety.

Results

Mature dehusked seeds from Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck were sterilized and inoculated on MS medium containing different concentrations of 2,4-D. After 3 weeks of incubation, yellowish white, light green, and green colored globular calli were generated (Fig. 1). Maximum callus induction frequency of Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck 89.33 ± 3.03% and 95.67 ± 4.04%, respectively, was found when MS medium was supplemented with 3 mg/l 2,4-D (Fig. 2). Yellowish white colored globular calli were selected for transformation. The selected calli of both species were pre-cultured on the same media for 3 days. Then pre-cultured calli were infected by immersing them in the infection medium (MS) containing both Agrobacterium strains for 90 min with intermittent gentle shaking and dried on sterile filter paper for 30 minutes. After 3 days of co-culture in dark on co-culture medium, calli were washed with 500 mg/l cefotaxime and transferred onto selection medium for fifteen days and was sub-cultured again on same selection medium (Fig. 1). The concentration of antibiotic was optimized via antibiogram of Agrobacterium strains and plant tissue sensitivity test (Fig. 3). At 500mg/l cefotaxime, clear zones were found and no harmful effect on plant tissue (callus) was observed after 7 days of treatment. After the second sub-culture, the GUS-histochemical assay was done and the frequency of GUS-positive calli was 83.33 ± 2.42% and 43 ± 2.00% for both species respectively (Fig. 4). Maximum GUS-positive results were found when 150-μM acetosyringone was added to the co-culture media and incubated for 3 days (Fig. 5). The fresh kanamycin-resistant calli were then transferred to the regeneration medium and sub-cultured on same media at an interval of 21 days. After 4 weeks of inoculation on regeneration medium, shoot (2–10 shoot per callus) generation started (Fig. 6). The frequencies of shoot induction were 61.11 ± 1.35% and 55.5 ± 1.03% for both species respectively, when MS medium was supplemented with 3.0 mg/l of BA and 2 mg/l of NAA (Fig. 7). The shoots obtained from differentiation of callus were taken and cultured on rooting medium [17]. Roots appeared within 20 days of inoculation. The genomic DNA was isolated from leaves of the putative transformed plantlets and non-transformed control plants and run on a 0.8% agarose gel for each sample (Fig. 8a). Transformation at genomic level was detected by amplifying GUS gene. Specific primers were used in PCR analysis to verify the presence of transgenes (GUS). Transgenic plantlets of both species produced bands of the expected size of 600 bp (Fig. 8b), whereas the corresponding bands were not found in control plants. The presence of reporter gene at the genomic level confirms the transformation of abiotic stress tolerant genes in two Citrus species. This result confirms the stable transformation of the transgenes and successful integration in the genome. In-vitro evaluations of the transgenic plants were performed in MS medium supplemented with different concentrations of NaCl (50, 100, 150, and 200 mM). The transgenic plantlets of two species remained fresh and survived for more than 4 weeks on MS medium supplemented with 50 mM NaCl, 2 weeks on 100 and 150 mM NaCl, and 1 week on 200 mM NaCl but control plantlets became pale within 5–7 days and died after 10 days (Fig. 9). These results confirm the expression of stress tolerant genes in these Citrus species.

Fig. 1
figure 1

Calli infected with Agrobacterium and washed with antibiotic. a calli induced from Citrus reticulata Blanco; b calli induced from Citrus sinensis (L.) Osbeck; c infected calli of Citrus reticulata Blanco; d infected calli of Citrus sinensis (L.) Osbeck; e: antibiotic-treated calli of Citrus reticulata Blanco, and f antibiotic-treated calli of Citrus sinensis (L.) Osbeck

Fig. 2
figure 2

Role of 2,4-D on callus induction in Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck

Fig. 3
figure 3

Antibiotic sensitivity test of explants and antibiogram of Agrobacterium strains. After seven days of inoculation of explants remained fresh (a) at 500 mg/l cefotaxime but became pale (b) at 600 mg/l cefotaxime and died at 700 mg/l, 800 mg/l (c, d). Clear zone were found at 500 mg/l cefotaxime in case of both strains PsCIPK (e) and PsCBL (f).

Fig. 4
figure 4

Assay of GUS activity in transformed calli of Citrus reticulata Blanco (a) and Citrus sinensis (L.) Osbeck (b). Arrow indicates the GUS-positive calli (blue spot)

Fig. 5
figure 5

GUS assay of the putatively transformed calli in different concentrations of acetosyringone

Fig. 6
figure 6

Effect of BA and NAA at different concentrations on regeneration of transformed calli Here, 1 = 2.0 BA + 1.0 NAA; 2 = 2.5 BA + 1.0 NAA; 3 = 3.0 BA + 1.5 NAA; 4 = 3.0 BA + 2.0 NAA; 5 = 3.5 BA + 2.5 NAA mg/l

Fig. 7
figure 7

Shoot and root induction from kanamycin resistant explants on MS medium of Citrus reticulata Blanco (a, c, e) and Citrus sinensis (L.) Osbeck (b, d, f)

Fig. 8
figure 8

a Represents the genomic DNA and b represents the PCR product of the GUS gene. Lane M1: 1 kb plus ladder DNA and M2: 1 kb ladder DNA; L1: DNA of control Citrus reticulata Blanco. L2: DNA of transformed Citrus reticulata (L.) Blanco. L3: DNA of control Citrus sinensis (L.) Osbeck. L4: DNA of transformed Citrus sinensis (L.) Osbeck

Fig. 9
figure 9

In vitro evaluation of transgenic and non-transgenic plantlets on MS medium containing different concentration of NaCl and 3 mg/l PEG after 10 days of inoculation

Discussion

In this research, Agrobacterium-mediated PsCBL and PsCIPK genes were transferred to citrus species, Citrus reticulata Blanco, and Citrus sinensis (L.) Osbeck using mature seed-derived calli. The previous study [18] reported that mature seed-derived callus was the most amenable explants for Agrobacterium-mediated transformation. Differences between various hormone supplementations were observed in callus induction. The efficiency of the Agrobacterium-mediated transformation method was inspected through vigilant observations of the effects of several parameters considered to be critical. The success of transformation was assessed by the percentage of blue spots signifying transient expression of GUS gene and the PCR detection of GUS gene. The density of Agrobacterium directly affects transformation efficiency since gene transfer only occurs with proper Agrobacterium attachment to plant cells. Therefore, high Agrobacterium concentration increased the number of plant cells being infected [19]. In this study, the highest number of GUS staining was observed in Agrobacterium suspension OD600 at 0.5. More concentrated Agrobacterium suspension (when OD600 was 0.8–1.0); however, significantly reduced the number of transformed cells due to the fact that intense Agrobacterium infection caused severe damage to the plant cells. The previous study [19] reported that bacteria concentration at OD600 0.6 to 0.8 was the most efficient in sweet potato embryogenic callus Agrobacterium-mediated transformation. Karami, 2008 [20] also reported that Agrobacterium concentration for transformation is dependent on multi-factors including Agrobacterium strain and viability, plant species, and cultivar and type of tissue used. The age of the callus is a crucial factor for transformation efficiency. Hiei and Komari, 2008 [21] reported that fresh and healthy immature embryos ensure the successful transformation. Young embryogenic callus is also favorable due to its higher regeneration ability as compared to old calli [22, 23]. Sharawat, 2007 defined the pre-culture period as the period that starts at the moment when immature embryos are first isolated and cultured immediately before Agrobacterium infection [24].

Zuraida et al. 2011 [25] showed that pre-culture period for more than 3 days improved transformation frequency. Four-day pre-cultured calli were used for Agrobacterium infection. During infection, the pre-culture calli were immersed in the infection medium for 90 mins with intermittent gentle shaking. The infected calli were dried for 30 mins on sterilized filter paper. Eighty-five transformation rate was recorded when calli were infected for 90 mins and dried for 30 mins [25]. In this study, infected calli were co-cultured for 3 days [25]. Zuraida et. al., 2011 stated a significant increase of transient GUS expressions were observed in 4 days of co-cultured calli but we found maximum GUS expression when co-cultured for 3 days. The influence of various acetosyringone concentrations (0, 100, 150, and 200 μM) in the co-culture medium were evaluated and significant GUS staining was achieved at the addition of 150 μM acetosyringone. A similar result was obtained in the transformation of sweet potato when the effect of acetosyringone concentration in co-cultivation medium was investigated [26]. After 3 days of co-cultured at the dark condition, the calli were washed with a washing solution containing 500 mg/l cefotaxime. The antibiotic concentration was selected through antibiogram of Agrobacterium and plant cell sensitivity test. Transient GUS gene expression was determined by GUS assay and PCR amplification of the GUS gene [27]. Almeida et al. 2003 stated that 81.5% GUS-positive result found in the Agrobacterium-mediated transformation of “Hamlin” sweet orange which is nearly similar to our result. Media composition, mainly the hormonal balance is an important factor influencing in-vitro culture initiation and plant regeneration from callus [28]. MS medium supplemented with 3 mg/l of 6-benzylaminopurine (BA) showed maximum regeneration efficiency for both Citrus species [29]. reported that the MS medium supplemented with 3 mg L-1 of 6-benzylaminopurine (BA) showed maximum regeneration efficiency of the transformed explants. Shoots were rooted on MS medium without supplementation of hormone [29,30,31,32] and the rooted plantlets were evaluated on stress conditions. The transgenic plantlets showed moderate resistance against abiotic stresses like salt.

Conclusion

The demand of Citrus (orange) is increasing day by day in Bangladesh. A huge amount of foreign currency is being spent for importing orange. It is possible to grow Citrus commercially, fulfill the national demand, and save foreign currency by eliminating the problems by developing good varieties. In this research, a reliable and efficient transformation system for two Citrus species was developed and transgenic plants with stable integration of target genes were recovered. This study will help for the development of Citrus varieties with desired traits.

Availability of data and materials

Authors declare that all generated and analyzed data are included in the article.

Abbreviations

2,4-D:

2,4-Dichlorophenoxyacetic acid

BA:

6-Benzylaminopurine

GUS:

β-glucuronidase

MS:

Murashige and Skoog

NAA:

1-Naphthaleneacetic acid

nptII :

Neomycin phosphotransferase II

OD600 :

Optical density at 600 nanometer UV light

PCR:

Polymerase chain reaction

PsCBL :

Calcineurin B-like protein of Pisum sativum

PsCIPK :

CBL-interacting protein kinases of Pisum sativum

UV:

Ultraviolet

References

  1. Kobayashi, S. 1994. Production of novel varieties through protoplast fusion in fruit trees. Research Journal of Food and Agriculture (Japan),.

  2. Liu, Yong-Zhong, and Xiu-Xin Deng. 2007. Citrus breeding and genetics in China. The Asian and Australasian Journal of Plant Science and Biotechnology 1 (1): 23–28. http://www.globalsciencebooks.info/JournalsSup/images/Sample/AAJPSB_1(1)23-28.pdf.

  3. Koltunow AM, Brennan P, Protopsaltis S, Nito N (2000) Regeneration of west indian limes (Citrus aurantifolia) containing genes for decreased seed set. Acta Hortic 3535:81–92 https://doi.org/10.17660/ActaHortic.2000.535.8

    Article  Google Scholar 

  4. Kim MC, Chung WS, Yun DJ, Cho MJ (2009) Calcium and calmodulin-mediated regulation of gene expression in plants. Molecular Plant 2(1):13–21 https://doi.org/10.1093/mp/ssn091

    Article  Google Scholar 

  5. Sanders, Dale, Jérôme Pelloux, Colin Brownlee, and Jeffrey F Harper. 2002. Calcium at the crossroads of signaling calcium signals : a central paradigm in. Plant Cell, 401–417. https://doi.org/10.1105/tpc.002899.Calcium.

  6. White PJ, Broadley MR (2003) Calcium in plants. Annals of Botany 92(4):487–511 https://doi.org/10.1093/aob/mcg164

    Article  Google Scholar 

  7. Hetherington AM, Brownlee C (2004) The generation of Ca2+ signals in plants annual. Annual Review of Plant Biology Vol. 55:401–427 https://doi.org/10.1146/annurev.arplant.55.031903.141624

    Article  Google Scholar 

  8. Hetherington AM, Ian Woodward F (2009) Access : the role of stomata in sensing and driving environmental change : nature the role of stomata in sensing and driving environmental change. Nature 424(August):6951–6951 https://doi.org/10.1038/nature01843

    Google Scholar 

  9. Scrase-Field, Sarah A.M.G., and Marc R. Knight. 2003. Calcium: just a chemical switch? Current Opinion in Plant Biology 6 (5): 500–506. https://doi.org/10.1016/S1369-5266(03)00091-8.

    Article  Google Scholar 

  10. Weinl, Stefan, and Jo¨rg Kudla. 2017. Joint pilot sequence design and power control for Max-Min fairness in uplink massive MIMO. IEEE International Conference on Communications, 517–528. https://doi.org/10.1109/ICC.2017.7996780.

  11. Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15:473–497

    Article  Google Scholar 

  12. Ambrosius S, Gundlach H, Kieser J (1996) Thermische Verwertung von Zementgebundenen Asbestprodukten in Zementöfen. ZKG International 49(8):444

    Google Scholar 

  13. Herrera-Estrella L, Depicker A, Van Montagu M, Schell J (1983) Expression of chimaeric genes transferred into plant cells using a Ti-plasmid-derived vector. Nature 303(5914):209–213 https://doi.org/10.1038/303209a0

    Article  Google Scholar 

  14. Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an overview. Archives of Biochemistry and Biophysics 444(2):139–158 https://doi.org/10.1016/j.abb.2005.10.018

    Article  Google Scholar 

  15. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19(1):11–15

    Google Scholar 

  16. Gambley, Rhonda L, Rebecca Ford, and Grant R Smith. 1993. Microprojectile transformation of sugarcane meristems and regeneration of shoots expressing Fl-glucuronidase. Plant Cell Reports (1993) 12: 343–346.

  17. Hossain, S. N., M. K. Munshi, M. R. Islam, L. Hakim, and M. Hossain. 2003. In vitro propagation of plum (Zyziphus Jujuba Lam.) 13 (1): 81–84.

  18. Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza Sativa L.) mediated by agrobacterium and sequence Analysis of the boundaries of the T-DNA. Plant J 6(2):271–282 https://doi.org/10.1046/j.1365-313X.1994.6020271.x

    Article  Google Scholar 

  19. Sahoo, Rupam, Rajib Sengupta, and Sanjay Ghosh. 2003. Nitrosative stress on yeast: inhibition of glyoxalase-I and glyceraldehyde-3-phosphate dehydrogenase in the presence of GSNO. Biochemical and Biophysical Research Communications 302 (4): 665–670. https://doi.org/10.1016/S0006-291X(03)00251-1.

    Article  Google Scholar 

  20. Karami O (2008) Transgenic Plant Journal ©2008 Global Science Books Factors Affecting Agrobacterium-Mediated Transformation of Plants

    Google Scholar 

  21. Hiei Y, Komari T (2008) Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nature Protocols 3(5):824–834 https://doi.org/10.1038/nprot.2008.46

    Article  Google Scholar 

  22. Raja NI, Bano A, Hamid R, Haroon Khan M, Chaudhry Z (2009) Efeect of age of embryogenic callus on plant regeneration in local cultivars of wheat (Triticum Aestivum L.). Pakistan J Botany 41(6):2801–2806

    Google Scholar 

  23. Bartlett, Joanne G, Sílvia C Alves, Mark Smedley, John W Snape, and Wendy A Harwood. 2008. High-throughput agrobacterium-mediated barley transformation 12: 1–12. https://doi.org/10.1186/1746-4811-4-22.

    Article  Google Scholar 

  24. Shrawat, A.K., D. Becker, and H. Lörz, Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L.). Plant Science, 2007. 172(2): p. 281–290.

    Article  Google Scholar 

  25. Zuraida, Ab Rahman, Ahmad Seman Zulkifli, Basirun Naziah, Lizah Julkifle Advina, Zainal Zamri, and Subramaniam Sreeramanan. 2011. Preliminary investigations of agrobacterium-mediated transformation in indica rice MR219 embryogenic callus using gusa gene.” African Journal of Biotechnology 10 (40): 7805–7813. https://doi.org/10.5897/ajb10.1436.

    Article  Google Scholar 

  26. Xing Y, Yang Q, Ji Q, Luo Y, Zhang Y, Ke G, Wang D (2007) Optimization of agrobacterium-mediated transformation parameters for sweet potato embryogenic callus using β-glucuronidase (GUS) as a reporter. African Journal of Biotechnology 6(22):2578–2584

    Article  Google Scholar 

  27. Almeida WA, Mourão Filho FD, Mendes BM, Pavan A, Rodriguez AP (2003) Agrobacterium-mediated transformation of Citrus sinensis and Citrus limonia epicotyl segments. Scientia Agricola 60(1):23–29 https://doi.org/10.1590/s0103-90162003000100005

    Article  Google Scholar 

  28. Cho MJ, Jiang W, Lemaux PG (1998) Transformation of recalcitrant barley cultivars through improvement of regenerability and decreased albinism. Plant Science 138(2):229–244 https://doi.org/10.1016/S0168-9452(98)00162-9

    Article  Google Scholar 

  29. Ali S, Mannan A, El Oirdi M, Waheed A, Mirza B (2012) Agrobacterium-mediated transformation of rough lemon (Citrus jambhiri Lush) with yeast HAL2 gene. BMC Res Notes 5(1):1 https://doi.org/10.1186/1756-0500-5-285

    Article  Google Scholar 

  30. Prodhan SH, Hasan N, Hammadul H, Alam SS, Raqibul M, Gupta A, Ummay M, Khatun S, Parvin A, Faruque Z (2016) Development of an efficient in vitro regeneration system for endangered wild orange. Citrus chrysocarpa L. 4531(October 2017):187–196

    Google Scholar 

  31. Hasan R, Mohammed AG, Hasan MN, Rejwan HM, Hasan R, Prodhan SH (2016) Efficient regeneration system for the improvement of Kinnow Mandarin (Citrus reticulata Blanco). Journal of Biology 6(7)

  32. Hasan R, Mohammed AG, Hasan MN, Fahim SM, Rejwan HM, Shamim MA, Siddique MAT, Prodhan SH (2016) Efficient callus initiation and plantlet regeneration of Citrus japonica Margarita. IOSR Journal of Pharmacy and Biological Sciences 11(04):72–78 https://doi.org/10.9790/3008-1104037278

    Article  Google Scholar 

Download references

Acknowledgements

The authors are thankful to the Department of Genetic Engineering and Biotechnology, Shahjalal University of Science & Technology, Sylhet, Bangladesh, for providing laboratory facilities and Dr. Narendra Tuteja for providing two Agrobacterium tumefaciens strains harboring PsCIPK and PsCBL genes.

Funding

The research was conducted with financial support of the Ministry of Science and Technology, Government of People’s Republic of Bangladesh.

Author information

Authors and Affiliations

Authors

Contributions

NH and SHP conceived and designed the experiments. NH analyzed the data NH and MK performed the experiment, NH and FHB wrote the manuscript, SI and HH reviewed and revised the manuscript, and SHP supervised and validated the data. All authors have read and approved the manuscript.

Corresponding author

Correspondence to Shamsul H. Prodhan.

Ethics declarations

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests..

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hasan, N., Kamruzzaman, M., Islam, S. et al. Development of partial abiotic stress tolerant Citrus reticulata Blanco and Citrus sinensis (L.) Osbeck through Agrobacterium-mediated transformation method. J Genet Eng Biotechnol 17, 14 (2019). https://doi.org/10.1186/s43141-019-0014-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43141-019-0014-3

Keywords