- Research
- Open access
- Published:
Genetic characteristics of complete mtDNA genome sequence of Indonesian local rabbit (Oryctolagus cuniculus)
Journal of Genetic Engineering and Biotechnology volume 21, Article number: 96 (2023)
Abstract
Background
Indonesian local rabbit (Oryctolagus cuniculus)Â is a local breed in Indonesia. We reveal the mitochondrial genome sequence of the Indonesian local Rabbit for the first time. A better understanding of the mechanisms underlying these beneficial aspects of local breeds over imported ones requires detailed genetic investigations, of which mtDNA genome sequencing is of particular importance. Such an investigation will solve the major issues of misidentification with Javanese hares (Lepus nigricollis) and maternal lineage. In addition, this information will guide better statistics on the Indonesian local rabbit breed population and strategies for its conservation and breeding plans. This study aimed to identify and explore the characteristics of the mtDNA genomes of Indonesian local rabbits.
Result
This study observed that the length of the mtDNA genome is 17,469Â bp, consisting of two ribosomal RNA (12S rRNA, 16S rRNA), 22 transfer RNA genes (trnR, trnG, trnK, trnD, trnS, trnY, trnC, trnN, trnA, trnW, trnM, trnQ, trnl, trnL, trnV, trnF, trnP, trnT, trnE, trnL, trnS, trnH), 13 protein-coding genes (PCGs) (ND4l, ND3, COX3, ATP6, ATP8, COX2, COX1, ND2, ND1, CYTB, ND6, ND5, ND4), a replication origin, and a noncoding control region (D-loop).
Conclusions
mtDNA genome of Indonesian local rabbit was the longest and had the most extended D-loop sequence among the other references of Oryctolagus cuniculus. Other specific differences were also found in the percentage of nucleotides and variation in most of the PCGs when they were aligned with Oryctolagus cuniculus references from GenBank. Indonesian local Rabbits strongly suspected brought from Europe during the colonial period in Indonesia.
Background
Rabbit (Oryctolagus cuniculus) has high economic value and a significant contribution to food and livelihood security, with the potential to be raised at the commercial level. Rabbit breeds in Indonesia are dominated by imported rabbit breeds and their crossbreeds, such as New Zealand White, Rex, Flemish Giant, Satin, and Angora [1]. Indonesian local rabbit breeds have been observed to have higher adaptability to tropical environmental conditions, with high-quality meat production, disease resistance, and better breeding ability [2]. Indonesian Local rabbits are included in medium-sized rabbits. They have coarse textured fur. Their adult body weight reaches only 2.5Â kg. Their colors covers from white, brown, black and combinations. Local rabbits are thought to have come from Dutch rabbits brought from the Netherlands around 100Â years ago. The male of Indonesian local rabbit breed was observed had a high genetic potential in the crossing with imported ones [3].
A better understanding of the mechanisms underlying these beneficial aspects of local breeds over imported ones requires detailed genetic investigations, of which mtDNA genome sequencing is of particular importance. Mitochondria is essential for metabolism, apoptosis [4], disease [5] and aging [6]. They carry out oxidative phosphorylation, which is necessary for the synthesis of ATP as well as a number of other metabolic processes. These subcellular organelles include a genome known as mitochondrial DNA (mtDNA), which is distinct from the nuclear chromatin and is frequently employed in studies of molecular phylogenetics [7]. Animal mtDNA typically has a short (15–20 kb) genome with 37 genes. Even while significantly bigger mitochondrial genomes have occasionally been identified, they are the result of mtDNA duplications rather than changes in gene composition [8, 9]. Thirteen protein subunits of the oxidative phosphorylation enzymes are encoded by a typical gene complement. Twenty-two tRNAs and ttwo rRNAs of the mitochondrial ribosome required for the translation of the proteins encoded by the mtDNA [10].
The mtDNA sequencing is of paramount importance in determining the maternal lineage and tracing the origin of locally available local rabbit breeds. In addition, it can determine the genetic distance and genetic relationship between Indonesian local rabbits and other rabbit breeds. White et al. [11] demonstrated that the genetic relationships of an organism can be investigated by genes that are maternally inherited by the offspring, as such genes do not experience recombination. It is to be kept in mind that till date only mtDNA sequences can be used to trace the origin of an organism, estimate the population diversity, determine conservation status, calculate genetic distance, and determine genetic relationships between subpopulations. This study aimed to identify and explore the characteristics of the mtDNA genomes of Indonesian local rabbits. Such an investigation will solve the major issues of misidentification with Javanese hares (Lepus nigricollis) and maternal lineage. In addition, this information will guide better statistics on the local rabbit breed population and strategies for its conservation and breeding plans. The results of this study are expected to provide information for additional examination of mtDNA sequences in favor of rabbit genetic research. Additionally, mtDNA genome sequencing analysis offers a fresh perspective on the genetic makeup of rabbits.
Methods
Ethical approval
The experimental procedures were approved by the Animal Research Ethics Committee of the Faculty of Animal and Agricultural Sciences, Universitas Diponegoro (No. 59–01/A-01/KEP-FPP).
Tissue collection and DNA extraction
This study used gDNA from an Indonesian local rabbit (Oryctolagus cuniculus) isolated from the liver tissue. The rabbit was slaughtered and dissected to collect the liver tissue. Tissue samples (10 g) were stored in Falcon tubes containing ethanol. Tissue samples were used to obtain gDNA. gDNA was extracted according to the manufacturer’s standard protocol using the Quick-DNA Magbead Plus Kit (Zymo Research, USA). The collected gDNA was then selected based on quality and quantity, and genomic mtDNA enrichment was conducted using the REPLI-g Mitochondrial DNA Kit (Qiagen, Germany). The library preparation process used the enhanced mtDNA.
WGS mtDNA sequencing and bioinformatic analysis
mtDNA sequencing was performed using WGS mtDNA analysis with nanopore technology [12, 13] by Oxford Nanopore Technologies GidION by PT. Genetika Science. Bioinformatics analysis was then performed. The workflow procedure for WGS, mtDNA, and bioinformatic analysis is shown in Fig. 1. The MinKNOW (v21.11.17) program was used to run the sequencing output from the Oxford Nanopore Technologies GridION sequencing. Guppy (v5.1.13) performed base calling in high-accuracy mode [14]. NanoPlot (v1.40.0) was used to visualize read quality [15]. Using minimap2 (v2.24), all readings were mapped to the mitochondrial reference sequence of Oryctolagus cuniculus from GenBank with accession number AJ001588 (New Zealand White / NZW1 rabbit by Gissi et al. [16]); MN953621 (Chuanbai Rex/CR rabbit) by Wang et al. [17]); MH985853 (New Zealand White / NZW2 rabbit by Hu et al. [18]) and MN296708 (Yimeng Wool / YW rabbit by Yao et al. [19]). Flye (v2.8.3) was used to perform the assembly using the filtered mapped reads [20]. A Nanoplot (v1.40.0) was used to assess the quality of mapped and filtered reads. Racon (v1.5.0) was used to polish the constructed sequence four times and Medaka (v1.5.0) was used three times ([21]; https://github.com/nanoporetech/medaka). MitoZ (v2.4) was used to annotate and visualize the final sequences [22]. Quast (v5.0.2) assessed the quality of constructed sequences [23].
Data analysis
Data analysis was conducted using the MEGA11 software [24]. Complete mtDNA sequences were aligned to identify the genetic characteristics of mtDNA in Indonesian rabbits, including size, nucleotide composition diversity and mutation. The sequence alignment was also used to visualize the phylogenetic tree. The phylogenetic tree was constructed using the Maximum Likelihood method [25] based on Indonesian local rabbit mtDNA complete sequences from this study and 19 sequences from GenBank consisting of Oryctolagus, Lepus, Cavia, Ochotona, and Brachylagus as a comparator (Table 1).
Result
mtDNA genome features of the Indonesian local rabbit
The results of the analysis showed that the mtDNA genome length of Indonesian local rabbits was 17,469 bp, consisting of two ribosomal RNA (12S rRNA, 16S rRNA), 22 transfer RNA genes (trnR, trnG, trnK, trnD, trnS, trnY, trnC, trnN, trnA, trnW, trnM, trnQ, trnl, trnL, trnV, trnF, trnP, trnT, trnE, trnL, trnS, trnH), 13 protein-coding genes (PCGs) (ND4l, ND3, COX3, ATP6, ATP8, COX2, COX1, ND2, ND1, CYTB, ND6, ND5, ND4), a replication origin, and a noncoding control region (D-loop) (Fig. 2, Table 2). The positions of trnS, trnY, trnC, trnN, trnA, trnQ, trnE, and ND6 are in the heavy strand (H), while the rest are in the light strand (L). Moreover, a replication origin of the light strand was 33 bp in length and between trnN and trnC. The nucleotide composition in this study showed that thymine (T) was the most abundant (31.4%), followed by adenine (A) (28.3%), guanine (G) (26.7%), and cytosine (C) (13.6%) (Table 3.). The genes with the highest G, C, T, and A compositions were trnP (ugg) (34.8%), ND1 (30.0%), ND6 (40.2%), and trnR (40.3%), respectively. In contrast, the lowest compositions of G, C, T, and A among the genes were ATP8 (7.8%), ND6 (6.7%), trnF (21.7%), and ND6 (19.8%), respectively.
Variation in the PCGs of the Indonesian local rabbit
The total length of 13 protein-coding genes (PCGs) in this study was 11.323Â bp, from the shortest to the longest sequence (bp), and amino acid (aa) lengths were as follows: ATP8 (204Â bp, 67 aa), ND4L (297Â bp, 98 aa), ND3 (357Â bp, 118 aa), ND6 (525Â bp, 174 aa), ATP6 (681Â bp, 226 aa), COX2 (684Â bp, 227 aa), COX3 (804Â bp, 267 aa), ND1 (957Â bp, 318 aa), ND2 (1044Â bp, 347 aa), CYTB (1140Â bp, 379 aa), COX1 (1542Â bp, 513 aa), ND5 (1812Â bp, 603 aa), and ND4 (1378Â bp, 459 aa). Nine of the 13 PCGs begin with the start codon ATG, while the rest start with the start codons ATA (ND3) and ATT (ND2, ND5, ND4). The stop codons in the Indonesian local rabbit sequence were dominated by TAG (ND3, COX3, COX2, COX1, ND1, and ND5), while the rest were TAA (ND4L, ATP6, ATP8, and ND2), AGG (CYTB and ND6), and TAT (ND4).
The Indonesian local rabbit (Oryctolagus cuniculus) in this study showed variation in most of the PCGs when they were aligned with all references (Supplementary data 1). Based on the alignment of the ND1 gene sequences, the Indonesian local rabbit had a longer ND1 sequence (957 bp) than all references (955 bp). There were insertions of 2 bp nucleotides which were A and G, in the end section of the ND1 gene. In addition, when the ND1 gene sequence of the Indonesian local rabbit was aligned with all references, a point mutation transition was found at site 456th (C➔T). However, this mutation was silent and did not alter the amino acid sequence. The ND3 gene sequence of the Indonesian local rabbit had length 357 bp. At the same time, when aligned with all references, there were a silent transition mutation at site 9th (A➔G) and the insertion of a 10 bp nucleotide (TGATAATTAG) in the end section of the ND3 gene.
The alignment results of the ND4L gene sequence showed that the Indonesian local rabbit had the same length compared to all references (297 bp). Nevertheless, when the Indonesian local rabbit ND4L gene sequence was aligned with all references, a transitional point mutation was found at site 162nd (G➔A) in the Indonesian local rabbit as a silent mutation. Similar to the ND4L gene results, the ND5 gene of the Indonesian local rabbit showed the same length in all references (1378 bp). However, when it came to alignment, there were several point mutations at certain sites, namely 187th (C➔G), 321st (C➔T), 891st (T➔C). The point mutation at site 187th (C➔G) was a transversion mutation, which was interpreted as a missense mutation and was located in the first codon. This resulted in different amino acid sequences between leucine (CTA) in the Indonesian local rabbit and valine (GTA) in all references. Mutations at sites 321st (C➔T) and 891st (T➔C) were transition mutations identified as silent mutations. Moreover, ND6, a missense point mutation, was found at site 16th (G➔A) when the Indonesian local rabbit was aligned with all references. This mutation in the first codon caused a difference in the Indonesian local rabbit with amino acid aspartic acid (GAT), compared to all references with asparagine (AAT).
The alignment results of the COX1 gene sequence of the Indonesian local rabbit showed the same length in all references (1542 bp) but varied at specific sites. These variations were found at site 1017th (A➔C) as a transversion mutation and at 1479 (G➔A) as a transition mutation; however, both mutations were silent. The sequence of the COX2 gene of the Indonesian local rabbit was 684 bp in length, which is similar to all references. However, there was a silent point mutation at site 207th (G➔A). Furthermore, an insertion was found in the end section of the COX3 gene in the Indonesian local rabbit that was 20 bp long with the sequence ACTCTTTTAGTATCAACTAG in the end section of the COX3 gene. Thus, the COX3 gene in the Indonesian local rabbit is 804 bp in length.
Further variations were also observed in ATP6. This study showed a 681 bp in length of ATP6 gene with the insertion of a 1 bp nucleotide at the end section of the ATP6 gene in an Indonesian local rabbit in the form of adenine. Conversely, the ATP8 gene of the Indonesian local rabbit showed no variation when aligned with all references, and it also had the same length (204 bp). The CYTB gene of the Indonesian local rabbit in this study was 1140 bp in length. When the CYTB gene sequence of the Indonesian local rabbit was aligned with all the references, there was a point mutation at site 571st (G➔A), which was interpreted as a missense mutation. This mutation in the first codon caused a difference in the amino acid sequence; the Indonesian local rabbit showed alanine (GCT), whereas all references showed threonine (ACT).
Variation in rRNA, tRNA and the D-loop of the Indonesian local rabbit
This study showed that the Indonesian local rabbit had a 12S rRNA sequence 957 bp in length and was between trnF and trnV. Furthermore, the alignment results between the Indonesian local rabbit and all references of the 12S RNA sequence showed a point mutation at site 587th (T➔C). Furthermore, sequencing results showed that the 16S rRNA sequence of the Indonesian local rabbit was 1581 bp, flanked by trnV and trnL. Moreover, the alignment results showed that there was variation at site 1110th in the 16S rRNA sequence caused by the transition mutation. This was C in an Indonesian local rabbit, whereas all references showed T. The total length of the 22 tRNA sequences of the Indonesian local rabbits was 1505 bp, with an average length of 68 bp. All tRNAs were distributed among PCGs, rRNA, and D_loop regions, with length ranging from 59 bp (trnS) to 75 bp (trnL). The D-loop sequence of the Indonesian local rabbit was located between trnF (gaa) and trnP (ugg). The Indonesian local rabbit D-loop sequence was 2.023 bp long. It were consisting of the specific sequence along 20 bp in length that was repeated 11 times and the specific sequence along 151 bp in length that was repeated five times.
Phylogenetic study
A phylogenetic tree was constructed based on the comparison of complete mitochondrial genome sequences of the Indonesian local rabbit (Oryctolagus cuniculus) and other 9 species of Leporidae family by the Maximum Likelihood method. Where bootstrap was set at 1000 for phylogeny test (Fig. 3). As one of Oryctolagus cuniculus sub-species, the Indonesian local rabbit in this study were in the same main clade with other Oryctolagus cuniculus (NZW, YW, CR) and close to Lepus sp. and Brachylagus sp. While Cavia sp. and Ochotona sp. were in different main clade.
Discussion
Result showed that the mtDNA genome of Indonesian local rabbit (17.469 bp) in this study was longer than that of CR rabbits (17.174 bp), YW rabbits (16.740 bp), and fractionally longer than that of New Zealand White rabbits (17.418 bp) [17,18,19]. Result in this study showed that the positions of trnS, trnY, trnC, trnN, trnA, trnQ, trnE, and ND6 are in the heavy strand (H), while the rest are in the light strand (L). These results was unique to those reported for YW rabbits by Yao et al. [19] and CR rabbits by Wang et al. [17], in which all protein-coding genes were found in the heavy strand, except for ND6, which was present in the light strand. Furthermore, both rabbits showed that tRNA, Gln, Ala, Asn, Cys, Tyr, Ser, Glu, and Pro were found on the light strand, whereas the other 14 tRNAs were found on the heavy strand. Other specific differences were also found in the percentage of nucleotides in the mtDNA genome of Oryctolagus cuniculus. The Indonesian local rabbit Oryctolagus cuniculus had a two-fold higher percentage of G than the average of other rabbits and outgroups (26% vs. ~ 13%), and the percentage of T was 2–3% higher than that of other rabbits and outgroups. However, the percentage of C was two-fold less than that of other rabbits and outgroups (26% vs. 13%), and the percentage of T was 2–3% lower than that in other rabbits and outgroups.
The difference result of the stop and start codons in PCGs of mtDNA genome of YW rabbits was reported by Yao et al. [19] that the ten protein-coding genes utilize the start codon ATG, except for ND2 and ND5, which use the start codon ATT, and ND3, which uses the start codon ATA. Regarding stop codons in the YW rabbit mtDNA genome, ND2 and ND4L end with TAA, COX2, and ND5 end with TAG, and ND6 ends with AGG. Eight genes also had an incomplete stop codon T– termination, which was the 5′ terminal of the gene next to them. They presumably created a complete stop codon via post-transcriptional polyadenylation, as reported by Anderson et al. [42]. Other previous findings showed that CR rabbits had the same start codon for PCGs as YW rabbits, excluding ND6, which had the start codon CCT, whereas for the stop codon, CR rabbits had TAT for ND1, TAA for ND2, ATP8, ATP6, and ND4L; TAG for COX1, COX2, and ND5; TCT for ND4; CAT for COX3 and ND6; ATA for ND3; and AGG for CYTB [17].
When the ND1 gene sequence of the Indonesian local rabbit was aligned with only CR rabbits [17], and variation were found at sites 316th (C➔T) and 791st (T➔C). The mutation at site 316th (C➔T) was a silent mutation, and the mutation at site 791st (T➔C) was a missense mutation located in the second codon. Proline (CCC) was detected in the CR rabbits and leucine (CTC) in The Indonesian rabbits. The ND3 gene sequence of the Indonesian local rabbit had the same length as the NZW2 rabbit ND3 gene sequence, which was 357 bp [18]. While the other references were only 347 bp long [16, 17, 19]. The insertion of a 10 bp nucleotide (TGATAATTAG) in the end section of the ND3 gene of the rabbit in this study indicated that Indonesian local rabbits had a longer amino acid sequence with the addition of tyrosine, aspartic acid, and asparagine.
The ND4L and ND5 gene sequence had the same length with all references [16,17,18,19] and found some mutations in certain sites that comprising a silent mutation in ND4L; 2 silent mutations and a missense mutation in ND5. Other than the three point mutations in ND5, there was also a point mutation found at site 1102nd (T➔C) as a transition mutation, which was also indicated as a silent mutation. However, this mutation was found when the Indonesian local rabbit was aligned with the CR rabbits [17]. Furthermore, two transition mutations were found in ND2 at sites 220th and 267th as A➔G when the Indonesian rabbits in this study were aligned with CR rabbits [17]. These mutations at site 220th of the first codon caused a difference in the amino acid sequence between isoleucine (ATT) in the Indonesian local rabbit and valine (GTT) in CR rabbits, while the mutation at site 267th was a silent mutation. In contrast, a mutation in ND4 was found at site 1370th (C➔T) only when the Indonesian local rabbit was aligned with the NZW1 and NZW2 rabbits [16, 18]. These mutations caused a difference in amino acids, such as proline (CCA) in Indonesian rabbits and leucine (CTA) in NZW1 and NZW2 rabbits. In contrast, when the Indonesian local rabbit ND4 gene sequence was aligned with the YW and CR rabbit ND4 gene sequences, no variation (monomorphic) was found [17, 19]. Based on Hoefs et al. [43], all ND genes including ND1, ND2, ND3, ND4, ND4L, ND5 and ND6 gene provided instructions for making a protein called NADH dehydrogenase. This protein is part of a large enzyme complex known as complex I. It is one of several enzyme complexes necessary for oxidative phosphorylation (OXPHOS) that carries out chemical reactions that drive the production of ATP. Complex I is also responsible for the first step of the electron transport process [44].
Moreover, when COX1 gene sequence of the Indonesian local rabbit was aligned with only CR rabbits [17], three point mutations were identified as transition mutations. These were located at site 569th (T➔C) and 1463rd (C➔T) in the second codon and 1252nd (T➔C) in the first codon, all of which were missense mutations. There were point mutations causing differences between isoleucine (ATC), phenylalanine (TTT), and threonine (ACA) in the Indonesian local rabbit, and threonine (ACC), leucine (CTT), and isoleucine (ATA) in the CR rabbit at sites 569th, 1252nd, and 1463rd, respectively. As another comparison between the Indonesian local rabbit with NZW1 rabbits and NZW2 rabbits [16, 18], a point mutation was found in the site 517th (C➔G) as transversion mutation that interpreted as a missense mutation. This mutation in the first codon led to differences in the amino acid proline (CCC) in the Indonesian local rabbit and alanine (GCC) in the NZW1 and NZW2 rabbits. At the same site, YW and CR rabbits showed no differences [17, 19]. Differently, the point mutation of COX2 gene sequence was at site 640th (G➔A) only when the Indonesian local rabbit was aligned with CR rabbits [17]. These were missense mutations and were present in the first codon, which caused a difference in amino acids at the site between valine (GTT) in the Indonesian local rabbit and isoleucine (ATT) in CR rabbits. According to Kadenbach [45], COX encodes a cytochrome oxidase c enzyme known as complex IV. It is the last enzyme in the respiratory electron transport chain of cells and is located in the membrane. COX plays a key role in the electron transport chain and catalyses the reduction of molecular oxygen to water. In addition, COX is responsible for the last step of OXPHOS before ATP generation [46].
ATP6 gene sequence in this study showed a 681Â bp in length and was the same as that in NZW2 rabbits and CR rabbits [17, 18]. Other studies (NZW1 and YW rabbits) showed a 680Â bp in length of ATP6 gene [16, 19]. Additionally, Anderson et al. [42], ATP genes play a role in encoding the ATP synthase enzyme, which is also known as complex V. This enzyme was responsible for the final OXPHOS step. More precisely, one component of ATP synthase permits the passage of positively charged particles (protons) through a unique membrane inside the mitochondria. The energy generated by this proton is used by another portion of the enzyme to convert adenosine diphosphate (ADP) into ATP.
CYTB codes for the production of cytochrome b protein. This protein is one of 11 components of a group of proteins called complex III. It performs one step in the OXPHOS process, in which oxygen and simple sugars are used to create adenosine triphosphate (ATP) as the cell's main energy source [47]. The CYTB gene of the Indonesian local rabbit in this study was the same length as NZW2, YW, and CR rabbits (1140 bp) [17,18,19], but longer than that of NZW1 rabbits [16] that had a 1 bp deletion in the end section of the CYTB gene. In addition, there was also a point mutation at sites 641st (A➔G) and 1103rd (T➔C) as missense mutations; however, these mutations were only found when the CYTB gene of the Indonesian local rabbit was aligned with CR rabbits [17]. Mutation at the site 641st (A➔G) and 1103rd (T➔C) in the second codon was causing a difference in amino acid sequence, where the Indonesian local rabbits showed Asparagine (AAC) and Leucine (CTC), whereas CR rabbits showed Serine (AGC) and Proline (CCC), respectively.
According to Yang et al. [48], ribosomal RNAs which are 12S rRNA and 16S rRNA that encoded by the mitochondrial genome are required to translate mRNA into mitochondrial proteins. Both rRNA which make approximately 1/16 for 12S rRNA and 1/10 for 16S rRNA of the whole mitochondrial genome, have many nucleotide changes. This study showed that the Indonesian local rabbit had a 12S rRNA sequence 957 bp in length and was between trnF and trnV. This is similar to the 12S rRNA sequences of NZW1 and CR rabbits [16, 17]. NZW2 and YW rabbits were reported to have 12S rRNA along 938 bp and 956 bp, respectively [18, 19]. Moreover, some point mutations were also found at sites 162nd (A➔G), 726th (T➔A), 771st (A➔T), and 791st (T➔C), but these mutations were present only when the Indonesian local rabbit was aligned with CR rabbits [17]. On the other hand, the length difference of the 12S rRNA sequence between the Indonesian local rabbit and NZW2 rabbit was due to a deletion of 19 bp in the middle region. At the same time, a 1 bp in length deletion was found in the end region of the 12S rRNA of YW rabbits.
Furthermore, sequencing results showed that the 16S rRNA sequence of the Indonesian local rabbit was 1581 bp, flanked by trnV and trnL. Prior researchers have reported results different from those of this study. NZW1 and CR rabbits were 1579 bp in length [16, 17]. The difference in the 16S rRNA sequence of both rabbits with the Indonesian local rabbit was due to the deletion of 2 bp in the beginning region of the 16S rRNA of NZW1 rabbits and CR rabbits. Other researchers reported that the YW rabbit had 1575 bp of 16S rRNA and it had a 6 bp in length deletion in the beginning region when compared to The Indonesian local rabbit 16S rRNA sequence. In contrast, Hu et al. [18] reported a shorter 16S rRNA sequence (1561 bp) in NZW2 rabbits than in this study and other studies. Deletion of 2 bp in the beginning region and 18 bp in the middle region of the 16S rRNA of NZW2 rabbits led to a length difference in this study. In addition, when 16S rRNA gene sequence of the Indonesian local rabbit was aligned only with the CR rabbits, the results showed more variation at sites 61st (T➔C), 636th (A➔G), and 982nd (A➔G).
tRNAs are mitochondrial components essential for the maturation of RNA into polycistronic transcripts. They decode an RNA molecule that aids in translating messenger RNA (mRNA) sequences into proteins [49]. These genes are frequently located between protein-coding and rRNA genes. In addition, based on Mauro et al. [50], vertebrate mitogenome organization is extremely conserved, and tRNA genes are involved in rearrangements in closely related taxa. Results of tRNAs in this study were showed similar to those obtained for NZW1 rabbit and CR rabbit tRNA sequences [16, 17]. In contrast, Yao et al. [19] reported that the lengths of 22 tRNA genes in YW rabbits ranged from 60 to 74Â bp.
Result of D-loop gene sequence in this study was highly different from NZW1 rabbits, particularly in terms of sequence length and character [16]. The Indonesian local rabbit D-loop sequence was 2.023 bp long, whereas NZW1 rabbits were 1.800 bp long. This difference was due to the presence of two specific sequences. First, the specific sequence along 20 bp in length was repeated 11 times in the Indonesian local rabbit D-loop, whereas in NZW1, the rabbit was only repeated eight times. Second, the specific sequence of 151 bp was repeated five times, whereas in NZW1, the rabbit was only repeated four times. According to the aligned sequences between the Indonesian local rabbit and NZW1 rabbit, there were 69 bp nucleotide insertions along the D-loop region of the Indonesian local rabbit. In addition, transitional mutations were also found at some points, where NZW1 rabbits showed cytosine, whereas Indonesian rabbits showed thymine (C > T).
Furthermore, another study reported that the D-loop sequence lengths were 2.010Â bp in NZW2 rabbits, which showed nine repetitions of 20Â bp of repetition sequence and three repetitions of 151Â bp of repetition sequence [18]; 1.743Â bp in CR rabbits, which showed five repetitions of 20Â bp of repetition sequence and three repetitions of 151Â bp of repetition sequence [17]; and 1.294Â bp in YW rabbits, which showed three repetitions of 20Â bp of repetition sequence and were only shown for one repetition sequence of 151Â bp [19]. These differences were the reason for the D-loop sequence of the Indonesian local rabbit, which had the most extended sequence among the other references from GenBank. These circumstances also affected the longer mtDNA genome sequences of the Indonesian local rabbit in this study compared to other GenBank references. These facts are the novelty of this MtDNA genome study of the Indonesian local rabbit, which has not been reported before.
The phylogenic tree described that within sub-species Oryctolagus cuniculus, the Indonesian local rabbit was in different branch and separated with NZW, YW and CR rabbit breed. The different among breed was in line with the morphologically distinctive among these rabbits. Indonesian local rabbits have short, coarse fur that is either black, white, agouty, or any mix of those colors. They have medium-sized of body with a maximum mature weight is only 2.5 kg [51]. NZW and CR are the rabbits with commercial body types. This body type is medium-sized, with a body depth that is uniformly equal to their body breadth. When viewed from above, there will be a little taper from the shoulder to the hips. A firmness of flesh and fullness of body are especially crucial for commercial-type rabbits because they are primarily kept for their meat. The adult body weight of both two breeds reached 5 kg and 3.6 kg for NZW and CR, respectively [52, 53]. The color of New Zealand rabbit was white, red, black and broken, while the rex has a broader variety of colors. In the other hand YW is native rabbit in Shandong Province of China. YW is a unique commercial animal with a large market potential due to its increased wool yield and better wool quality, which increases its economic worth [54].
This difference of branch was an evidence and a consequence of the unique specific sequences possessed by only Indonesian local rabbits in this study. The study reported phylogeny of rabbits from complete mtDNA genome was limited. The specific genes have been used for phylogeny studies were Cytochrome b, 12SrNA, 16S rRNA MGF, PRKCI, SPTBN1, THY, and TG [55,56,57]. They reported that Oryctolagus cuniculus known as European rabbit was separated but closely from Pentalagus, Caprolagus and Bunolagus. Based on geographical cluster, Pentalagus, Caprolagus, Bunolagus, and Oryctolagus were originated from South Asia, India, South Africa and Europe, respectively. In the level of subspecies, the study in Egypt reported that Baladi Black, California, Chinchilla, Flander, New Zealand white and Rex were grouped as Oryctolagus cuniculus [58]. Based on the result, Indonesian local Rabbits strongly suspected brought from Europe during the colonial period in Indonesia.
Conclusions
mtDNA genome of Indonesian local rabbit was the longest and had the most extended D-loop sequence among the other references of Oryctolagus cuniculus. Other specific differences were also found in the percentage of nucleotides and variation in most of the PCGs when they were aligned with Oryctolagus cuniculus references from GenBank. According to phylogeny analysis Indonesian local Rabbits strongly suspected brought from Europe during the colonial period in Indonesia.
Availability of data and materials
All data are primary data and generated from our original research. All research materials belong to our laboratory in Genetic, Breeding and Reproduction Laboratory, Department of Animal Science, Faculty of Animal and Agricultural Sciences, Universitas Diponegoro.
Abbreviations
- A:
-
Adenine
- aa:
-
Amino acid
- ATP:
-
Adenine triphosphate
- bp:
-
Base pair
- C:
-
Cytosine
- COX:
-
Cytochrome oxidase
- CR:
-
Chuanbai Rex
- CYTB:
-
Cytochrome b
- D-loop:
-
Displacement loop
- DNA:
-
Deoxyribonucleic acid
- G:
-
Guanine
- MEGA:
-
Molecular evolutionary genetic analysis
- mtDNA:
-
Mitochondrial DNA
- ND:
-
NADH dehydrogenase
- NZW:
-
New Zealand White
- PCGs:
-
Protein coding gene
- RNA:
-
Ribonucleic acid
- rRNA:
-
Ribosomal RNA
- T:
-
Tymine
- tRNA:
-
Transfer RNA
- trnA:
-
TRNA alanine
- trnC:
-
TRNA cysteine
- trnD:
-
TRNA aspartic acid
- trnE:
-
TRNA glutamic acid
- trnF:
-
TRNA phenylalanine
- trnG:
-
TRNA glycine
- trnH:
-
TRNA histidine
- trnK:
-
TRNA lysine
- trnl:
-
TRNA isoleusine
- trnL:
-
TRNA leucine
- trnM:
-
TRNA methionine
- trnN:
-
TRNA asparagine
- trnP:
-
TRNA proline
- trnQ:
-
TRNA glutamine
- trnR:
-
TRNA arginine
- trnS:
-
TRNA serine
- trnT:
-
TRNA threonine
- trnV:
-
TRNA valine
- trnW:
-
TRNA tryptophan
- trnY:
-
TRNA tyrosine
- WGS:
-
Whole genome sequencing
- YW:
-
Yimeng Wool
References
Brahmantiyo B, Martojo H, Manjoer SS, Raharjo YC (2006) Pendugaan jarak genetik kelinci melalui analisis morfometrik. Jurnal Ilmu Ternak Veteriner 11(3):206–214
Kusuma IGPE, Dewi GAMK, Nuriyasa IM (2017) Pengaruh suplementasi mineral block pada pakan dasar rumput lapangan terhadap performans dan karkas kelinci jantan lokal. Majalah Ilmiah Peternakan 20(3):106–110. https://doi.org/10.24843/MIP.2017.v20.i03.p04
Setiaji A, Kurnianto E, Sutopo S (2022) Partial diallel cross for assessing genetic merit of local rabbit breed. World Rabbit Sci 30(3):195–200. https://doi.org/10.4995/wrs.2022.14990
Vakifahmetoglu-Norberg H, Ouchida AT, Norberg E (2017) The role of mitochondria in metabolism and cell death. Biochem Biophys Res Commun 482(3):426–431. https://doi.org/10.1016/j.bbrc.2016.11.088
Annesley SJ, Fisher PR (2019) Mitochondria in health and disease. Cells 8(7):680. https://doi.org/10.3390/cells8070680
Macêdo APA, da Silva ASR, Muñoz VR, Ropelle ER, Pauli JR (2021) Mitochondrial dysfunction plays an essential role in remodeling aging adipose tissue. Mech Ageing Dev 200:111598. https://doi.org/10.1016/j.mad.2021.111598
Fernández-Silva P, Enriquez JA, Montoya J (2003) Replication and transcription of mammalian mitochondrial DNA. Exp Physiol 88(1):41–56. https://doi.org/10.1113/eph8802514
Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Res 27(8):1767–1780. https://doi.org/10.1093/nar/27.8.1767
Rokas A, Ladoukakis E, Zouros E (2003) Animal mitochondrial DNA recombination revisited. Trends Ecol Evol 18(8):411–417. https://doi.org/10.1016/S0169-5347(03)00125-3
Mears JA, Sharma MR, Gutell RR, McCook AS, Richardson PE, Caulfield TR, Agrawal RK, Harvey SC (2006) A structural model for the large subunit of the mammalian mitochondrial ribosome. J Mol Biol 358(1):193–212. https://doi.org/10.1016/j.jmb.2006.01.094
White DJ, Wolff JN, Pierson M, Gemmell NJ (2008) Revealing the hidden complexities of mtDNA inheritance. Mol Ecol 17(23):4925–4942. https://doi.org/10.1111/j.1365-294X.2008.03982.x
Zascavage RR, Thorson K, Planz JV (2018) Nanopore sequencing: an enrichment-free alternative to mitochondrial DNA sequencing. Electrophoresis 40(2):272–280. https://doi.org/10.1002/elps.201800083
Zascavage RR, Hall CL, Thorson K, Mahmoud M, Sedlazeck FJ, Planz JV (2019) Approaches to whole mitochondrial genome sequencing on the Oxford Nanopore MinION. Curr Protoc Hum Genet 104(1):e94. https://doi.org/10.1002/cphg.94
Wick RR, Judd LM, Holt KE (2019) Performance of neural network base calling tools for Oxford Nanopore sequencing. Genome Biol 20:129–139. https://doi.org/10.1186/s13059-019-1727-y
De Coster W, D’Hert S, Schultz DT, Cruts M, Broeckhoven VC (2018) NanoPack: visualizing and processing long-read sequencing data. Bioinformatics 34(15):2666–2669. https://doi.org/10.1093/bioinformatics/bty149
Gissi C, Gullberg A, Arnason U (1998) The complete mitochondrial DNA sequence of the rabbit. Oryctolagus cuniculus Genomics 50(2):161–169. https://doi.org/10.1006/geno.1998.5282
Wang X, Zeng HM, Wang Y, Luo Y, Yao XP, Yang Z (2021) The complete mitochondrial DNA sequence of Chuanbai Rex rabbit (Oryctolagus cuniculus). Mitochonrial DNA B Resour 6(1):129–130. https://doi.org/10.1080/23802359.2020.1848476
Hu S, Zhou J, Chen Y, Wu X (2018) Mitochondrial DNA sequence of New Zealand white rabbit. (Direct access in NCBI GenBank with accession number MH985853). Available in: https://www.ncbi.nlm.nih.gov/nuccore/MH985853
Yao C, Li Y, Liu L, Ma C, Liu YG, Liu YH (2019) The complete mitochondrial DNA sequence of Yimeng wool rabbit. Mitochondrial DNA B Resour 4(2):3858–3859. https://doi.org/10.1080/23802359.2019.1687022
Kolmogorov M, Yuan J, Lin Y, Pevzner PA (2019) Assembly of long, error-prone reads using repeat graphs. Nat Biotechnol 37(5):540–546. https://doi.org/10.1038/s41587-019-0072-8
Vaser R, Sovic I, Nagarajan N, Sikic M (2017) Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res 27(5):737–746. https://doi.org/10.1101/gr.214270.116
Meng G, Li Y, Yang C, Liu S (2019) MitoZ: a toolkit for animal mitochondrial genome assembly, annotation and visualization. Nucl Acids Res 47(11):e63. https://doi.org/10.1093/nar/gkz173
Gurevich A, Saveliev V, Vyahhi N, Tesler G (2013) Quast: quality assessment tool for genome assemblies. Bioinformatics 29:1072–1075. https://doi.org/10.1093/bioinformatics/btt086
Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol Bio Evol 38(7):3022–3027. https://doi.org/10.1093/molbev/msab120
Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10:512–526. https://doi.org/10.1093/oxfordjournals.molbev.a040023
Wang JL, Yang G (2010) Mitochondrion Lepus capensis (brown hare). (Direct access in NCBI Genbank with accession number GU937113.1). Available in: https://www.ncbi.nlm.nih.gov/nuccore/GU937113.1
Yu JN, Kwak M (2013) The complete mitochondrial genome of Korean hare (Lepus coreanus, Thomas 1892). (Direct access in NCBI Genbank with accession number KF040450.1). Available in: https://www.ncbi.nlm.nih.gov/nuccore/KF040450.1
Arnason U, Adegoke JA, Bodin K, Born EW, Esa YB, Gullberg A, Nilsson M, Short RV, Xu X, Janke A (2002) Mammalian mitogenomic relationships and the root of the eutherian tree. Proc Natl Acad Sci USA 99(12):8151–8156. https://doi.org/10.1073/pnas.102164299
Nilson MA, Gullberg A, Spotorno E, Arnason U, Janke A (2003) Radiation of extant marsupials after K/T boundary: evidence from complete mitochondrial genomes. J Mol Evol 57:3–12. https://doi.org/10.1007/s00239-003-0001-8
Giannoulis T, Starnatis C, Tsipourlianos A, Mamuris Z (2018) Mitogenome analysis in European brown hare (Lepus europaeus) proposes genetic and functional differentiation between the distinct lineages. Mitochondrial DNA A DNA Mapp Seq Anal 29(3):353–360. https://doi.org/10.1080/24701394.2016.1278540
Melo-Ferreira J, Vilela J, Fonseca MM, da Fonseca RR, Boursot P, Alves PC (2014) The elusive nature of adaptive mitochondrial DNA evolution of an arctic lineage prone to frequent introgression. Genome Biol Evol 6(4):886–896. https://doi.org/10.1093/gbe/evu059
Wang X, Kong L, Y Li (2011) The content and structure of the complete mitochondrial genome sequences of Lepus hainanus and the phylogenetic position of Lepus hainanus according to the mitogenome (Direct access in NCBI Genbank with accession number JQ219662.1). Available in: https://www.ncbi.nlm.nih.gov/nuccore/JQ219662.1
Ding L, Chen C, Wang H, Zhang B (2016) Complete mitochondrial DNA sequence of Lepus tolai (Leporidae: Lepus). Mitochondrial DNA A DNA Mapp Seq Anal 27(3):2085–2086. https://doi.org/10.3109/19401736.2014.982568
Fu Y (2015) The complete mitochondrial genome of Lepus timidus's genetic structure, genetic diversity and phylogenetic evolution. (Direct access in NCBI Genbank with accession number KR030072). Available in: https://www.ncbi.nlm.nih.gov/nuccore/KR030072
Ding L, Chen M, Pan T, Zhang B, Zhou Y, Wang H (2016) Complete mitochondrial DNA sequence of Lepus sinensis (Leporidae: Lepus). Mitochondrial DNA A DNA Mapp Seq Anal 27(3):1711–1712. https://doi.org/10.3109/19401736.2014.961134
Shan W, Tursun M, Zhou S, Zhang Y, Dai H (2020) The complete mitochondrial genome sequence of Lepus tolai in Xinjiang. Mitochondrial DNA B Resour 5(2):1336–1337. https://doi.org/10.1080/23802359.2020.1735267
Shan W (2019) Mitochondrion Lepus yarkandensis (Yarkand hare). (Direct access in NCBI Genbank with accession number MN539747). Available in: https://www.ncbi.nlm.nih.gov/nuccore/MN539747
Huang YL, Chen YX, Guo HT, Xu YH, Liu HY, Liu DW (2019) The complete mitochondrial genome sequence of Yarkand hare (Lepus yarkandensis). Mitochondrial DNA B Resour 4(2):3727–3728. https://doi.org/10.1080/23802359.2019.1681321
Wahedi A, Gunther A, Weyrich A, Sondheimer N (2020) Mitochondrion Cavia porcellus (domestic guinea pig). Direct access in NCBI Genbank with accession number MT017565). Available in: https://www.ncbi.nlm.nih.gov/nuccore/MT017565
Gissi C, Pesole G (2004) The mitochondrial genome of the lagomorph Ochotona princeps. (Direct access in NCBI Genbank with accession number NC_005358). Available in: https://www.ncbi.nlm.nih.gov/nuccore/NC_005358
Saha A, Baca M, Popovic D, Mohammadi Z, Olsson U, Fostowicz-Frelik L (2022) The first complete mitochondrial genome data of the pygmy rabbit Brachylagus idahoensis, the world’s smallest leporid. Data Brief 42:2–8. https://doi.org/10.1016/j.dib.2022.108314
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981) Sequence and organization of the human mitochondrial genome. Nature 290:457–465. https://doi.org/10.1038/290457a0
Hoefs SJG, Rodenburg RJ, Smeitink JAM, Heuvel LP (2012) Molecular base of biochemical complex I deficiency. Mitochondrion 12(5):520–532. https://doi.org/10.1016/j.mito.2012.07.106
Voet DJ, Voet JG, Pratt CW (2013) Chapter 18, Mitochondrial ATP synthesis. Fundamentals of Biochemistry (4th ed.). Wiley, Hoboken, pp. 581–620
Kadenbach B (2021) Complex IV – The regulatory center of mitochondrial oxidative phosphorylation. Mitochondrion 58:296–302. https://doi.org/10.1016/j.mito.2020.10.004
Kadenbach B, Huttemann M (2015) The subunit composition and function of mammalian cytochrome c oxidase. Mitochondrion 24:64–76. https://doi.org/10.1016/j.mito.2015.07.002
Borlado MCG, Lastres DM, Hoyuela MG, Moran M, Blazquez A, Pello R, Buera LM, Gabaldon T, Penas JJG, Martin MA, Arenas J, Ugalde C (2010) Impact of the mitochondrial genetic background in complex III deficiency. PLoS ONE 5(9):e12801. https://doi.org/10.1371/journal.pone.0012801
Yang L, Tan Z, Wang D, Xue L, Guan MX, Huang T, Li R (2014) Species identification through mitochondrial rRNA genetic analysis. Sci Rep 4:4089. https://doi.org/10.1038/srep04089
Silva PF, Enriquez JA, Montoya J (2003) Replication and transcription of mammalian mitochondrial DNA. Exp Physiol 88:41–56. https://doi.org/10.1113/eph8802514
Mauro DS, Gower DJ, Zardoya R, Wilkinson M (2006) A Hotspot of gene order rearrangement by tandem duplication and random loss in the vertebrate mitochondrial genome. Mol Biol Evol 23(1):227–234. https://doi.org/10.1093/molbev/msj025
Setiaji A, Lestari DA, Kurnianto E, Sutopo S (2022) Morphometric traits of imported rabbits and their progenies. J Adv Vet Res 12(3):217–220
Setiaji A, Kurnianto E, Sutopo S, Lestari DA (2023) Morphological structure of rabbits based on body types. J Adv Vet Res 13(2):188–192
Setiaji A, Sutopo S, Kurnianto E (2013) Growth analysis in rabbit using Gompertz non-linear model. J the Indo Trop Anim Agric 38(2):92–97. https://doi.org/10.14710/jitaa.38.2.92-97
Zhang L (2018) Study on polymorphism in the 50 regulatory region of candidate genes and their associations with wool traits of the wool rabbits. Master thesis, Shandong Agricultural University
Robinson TJ, Matthee CA (2005) Phylogeny and evolutionary origins of the Leporidae: a review of cytogenetics, molecular analyses and a supermatrix analysis. Mammal Rev 35(3 & 4):231–247. https://doi.org/10.1111/j.1365-2907.2005.00073.x
Matthee CA, Van Vuuren BJ, Bell D, Robbinson TJ (2004) A molecular supermatrix of the rabbits and hares (Leporidae) allows for the identification of five intercontinental exchanges during the Miocene. Syst Biol 53(3):433–447. https://doi.org/10.1080/10635150490445715
Petrescu-Mag IV, Papuc T, Oroian I, Botha M (2019) A review of the phylogeny of the European rabbit (Oryctolagus cuniculus). Rabbit Gen 9(1):1–9
Allam M, Mahrous NS (2021) Molecular genetic diversity of some rabbit breeds on mitochondrial 16S rRNA sequences. World Rabbit Sci 29:193–201. https://doi.org/10.4995/wrs.2021.15110
Acknowledgements
All authors thank to Lembaga Penelitian dan Pengabdian Masyarakat, Universitas Diponegoro for all financial support for this research through Riset Publikasi Internasional (RPI).
Funding
All source of funding of this research were obtained from Riset Publikasi Internasional (RPI) by Lembaga Penelitian dan Pengabdian Masyarakat, Universitas Diponegoro with contract number 569–82/UN7.D2/PP/VII/2022.
Author information
Authors and Affiliations
Contributions
AS, DAL and NSP designed the study. AS, DAL, NSP, IA performed experiment. DAL analyzed and interpreted the data, preparing and writing the manuscript. NSP, IA and FAK took part in critical checking the manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
The experimental procedures were approved by the Animal Research Ethics Committee of the Faculty of Animal and Agricultural Sciences, Universitas Diponegoro (No. 59–01/A-01/KEP-FPP).
Consent for publication
Not applicable.
Competing interests
All authors declare that they have no competing interest.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1.
Genetic characteristics of complete mtDNA genome sequence of Indonesian Local rabbit (Oryctolagus cuniculus) (2023).
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Setiaji, A., Lestari, D.A., Pandupuspitasari, N.S. et al. Genetic characteristics of complete mtDNA genome sequence of Indonesian local rabbit (Oryctolagus cuniculus). J Genet Eng Biotechnol 21, 96 (2023). https://doi.org/10.1186/s43141-023-00546-1
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s43141-023-00546-1