Skip to main content
Journal of Genetic Engineering and Biotechnology
Download PDF

Bio-diagnostic performances of microRNAs set related to DNA damage response pathway among hepatitis C virus-associated hepatocellular carcinoma patients

Journal of Genetic Engineering and Biotechnology volume 21, Article number: 85 (2023) Cite this article

Abstract

Background

Up to date, a well-defined microRNAs (miRNAs) profile involved in hepatocellular carcinoma (HCC) pathogenesis remains indecisive. Thus, employing miRNAs for HCC diagnosis is demanded for early therapeutic interventions. We aimed to evaluate the usage of miRNAs set related to the SuperPath: miRNAs involved in DNA damage response pathway as effective biomarkers for HCV-related HCC diagnosis.

Results

The study enrolled 97 patients with HCV-related HCC, 84 with hepatitis C virus (HCV), 97 with liver cirrhosis (LC), and 84 healthy individuals. Serum miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 were quantified using qRT-PCR experiments, AFP and routine LFTs were estimated via standard techniques. Pathway enrichment analysis along with the construction of miRNAs regulatory network were performed. With respect to healthy individuals, miRNA-203, miRNA-100-5p, and miRNA-16 were significantly downregulated in HCC, HCV, and LC groups, while miRNA-23a showed significant upregulation (p < 0.001). miRNAs exhibited significant correlations with AFP, ALT, AST, and albumin. Also, elevated levels of miRNA-23a were recognized in patients with multiple focal lesions and/or lesion size > 5 cm. Additionally, the diagnostic performance of miRNA-23a expression level at a selected cut-off value of 3.99 overtakes AFP, while expressions of miR-203, miRNA-100-5p, and miRNA-16 represent poor diagnostic outcomes.

Conclusions

Keeping in mind the individual variability and high level of heterogeneity in HCC, our data revealed the diagnostic value of miRNA-23a expression in HCV-related HCC patients. Further extra in silico HCC-specific microRNAs sets are demanded in diagnosis.

Background

Hepatocellular carcinoma (HCC) accounts for 90% of primary liver cancers [1] and it represents the third most common cause of death from cancer worldwide, with an increasing incidence expected in the next decades [2]. The major risk factors are chronic viral hepatitis B and C (HBV and HCV), alcohol abuse, primary biliary cirrhosis, xenobiotics, diabetes, non-alcoholic fatty liver disease, and genetic disorders such as hemochromatosis and α1-antitrypsin deficiency [3, 4], autoimmune hepatitis, PAPSS1 locus, hypothyroidism, glycogen storage disease (type Ιa and type Ιb) and acute intermittent [1]. Early diagnosis of HCC is crucial for improving the survival rate of patients. Early detection using serum alpha-fetoprotein (AFP) level is limited by its low sensitivity [5], so there is an urgent demand to develop new non-invasive biomarkers with high accuracy and feasibility.

Micro-ribonucleic acids (miRNAs) represent an abundant class of endogenous small RNA molecules of 20–25 nucleotides in length capable of regulating gene expression either by direct cleavage of targeted messenger RNAs (mRNAs) or by inhibiting translation through complementarity to targeted mRNAs at the 3\-untranslated regions (UTRs) [6]. Deregulated expression of miRNA has been linked to a variety of cancers, including HCC [7]. Differential expression of miRNAs between tumor and normal tissues as well as the stability of microRNAs in serum and plasma establish the role of miRNAs as non-invasive efficient biomarkers in cancer diagnostics [7].

A line of evidence supported that miRNAs are considered powerful biological target molecules for HCC diagnosis and/or therapy. Besides, these circulating miRNAs can modulate several downstream target genes and signaling pathways in HCC. However, little is known concerning the underlying mechanisms as well as the association of miRNAs profiles with the pathogenesis of HCC of various etiologies, in addition to the limited number of miRNA-based clinical trials [8].

The current study aimed to assess using of serum miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 as predictive biomarkers for early detection of HCV-induced HCC, in addition, to highlight the links of these miRs with other laboratory indices and tumor characteristics. These miRNAs were included as microRNAs related to the SuperPath “miRNAs involved in DNA damage response pathway” and were chosen according to the bioinformatics databases.

Methods

The study included 362 subjects recruited from National Hepatology and Tropical Medicine Research Institute Cairo, Egypt, between July 2019 and December 2021. Participants were categorized into 84 healthy subjects, 97 patients with liver cirrhosis, 84 patients with HCV, and 97 patients with HCC. Informed consents were obtained from participants prior to their enrollment in the study and approved by the ethical committee for Human Subject Research at National Hepatology and Tropical Medicine Research Institute. Patients with viral infections other than HCV, alcohol abuse, primary biliary cirrhosis, xenobiotics, non-alcoholic fatty liver disease, genetic disorders, and other cancers or metastatic liver cancer were excluded. All patients were submitted to detailed history and clinical assessment. Liver cirrhosis was diagnosed based on history, clinical examination, laboratory findings, and abdominal ultrasonography. The severity of liver disease was assessed by the Child-Pugh score [9]. HCC was diagnosed by abdominal ultrasonography; abdominal triphasic computed tomography (CT), and serum AFP and confirmed to be HCC by histologic assessment of liver biopsy. Tumor characteristics were detected including tumor size, focal lesion number, site, and portal vein invasion. Tumor staging was performed according to the Okuda staging system [10]. Fasting blood samples were collected from all participants for analysis of serum alpha-fetoprotein, liver function tests, and prothrombin time (as International normalization ratio (INR)).

Total RNA was isolated according to the manufacturer’s protocols using RN easy mini kit (Qiagen, Valencia, CA, and the USA, Cat. 74134). For qRT-PCR experiments, quantification of Micro-RNAs was performed using TaqMan Gene Expression (Applied Biosystems, Waltham, Massachusetts, USA, Cat. # 4427975). RNAU6 was used as a housekeeping gene (endogenous control) in this study. The primers for miR-100-5p were F: 5’-GAACCCGTAGATCCGAACT-3’ and R: 5’-CAGTGCGTGTCGTGGAGT-3’, for miR-203 were F: 5' CACTCCAGCTGGGGTGAAATGTTTAGGACCA, R: 5' CTCAACTGGTGTCGTGGA, for miR-16 F: 5’TAGCAGCACGTAAATATTGGCG3’, for miRNA-23a, 5'-AUCACAUUGCCAGGGAUUUCC-3', for U6 were F: 5’-CTCGCTTCGGCAGCACA-3’ and R: 5’-AACGCTTCACGAATTTGCGT-3’ respectively. The amplification conditions were 95 °C for 10 min, followed by 40 amplification cycles of 95°C for 15 s and 60 °C for 60 s. The expression levels of miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 were normalized to the controls and the fold change of each miRNA was calculated using the 2−ΔΔCt method.

Data were statistically analyzed using SPSS software (V23). One-way ANOVA was used for between-groups comparisons. Data are presented as mean ± standard deviation (SD). Correlations between the variables were analyzed using Pearson’s correlation coefficient. The diagnostic performances of studied miRs were evaluated via the Receiver operator characteristic (ROC) area under the curve (AUC) and the best cut-off values with their selected sensitivity, specificity, and positive and negative predictive values were calculated. P value < 0.05 was considered significant.

Bioinformatics analysis included (1) Enrichment and Gene ontology (GO): the biological processes and gene ontology of miRNAs were obtained according to David functional annotation and GeneAnalytics (https://geneanalytics.genecards.org/). Also, the gene set enrichment analysis in addition to the pathways involved from KEGG Reactome and WikiPathways were performed using the gProfiler online software tool (http://biit.cs.ut.ee/gprofiler/gost). The circulating miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 were involved in the DNA damage response pathway (Homo sapiens) [WP:WP1545]. More info can be available via the National Cancer Institute’s Clinical Proteomic Tumor Analysis Consortium (CPTAC) Assay Portal (https://assays.cancer.gov/available_assays?wp_id=WP1545). (2) MiRNAs regulatory network construction: the targets of miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 were predicted using miRTargetLink 2.0 databases (https://www.ccb.uni-saarland.de/mirtargetlink2).

Results

Demographic and laboratory data are shown in (Table 1). The biochemical parameters aspartate aminotransferase (AST), alanine aminotransferase (ALT), albumin, bilirubin, and α-fetoprotein (AFP), were as expected, within the reference range for control subjects. Among the patient groups, ALT, AST, prothrombin concentration, and AFP were significantly elevated as compared to the healthy controls. Notably, there were no significant differences in AFP serum levels in HCV as compared to HCC and cirrhosis patients. miRNAs expression levels were dysregulated as serum miRNA-203, miRNA-100-5p, and miRNA-16 were significantly downregulated in HCC and HCV patients, while miRNA-23a showed significant up-regulation with respect to health subjects (p < 0.001).

Table 1 Demographic and laboratory data of all studied groups
Full size table

Micro-RNA-23a was directly correlated with serum AST, ALT, and AFP and inversely correlated with serum albumin. Contrariwise miRNA-203, miRNA-100-5p, and miRNA-16 represented vice versa correlations with the previous indices. Also, serum miRNA-203 and miRNA-16 were inversely correlated with miRNA-23a (Table 2).

Table 2 Correlations matrix among serum miRNAs and liver function indices
Full size table

Regarding the Okuda staging system, 12.28% of HCC patients presented in stage I, 40.35% of HCC patients presented in stage II, and 47.37% of HCC patients presented in stage III. Imaging showed that all HCC occurred on top of cirrhosis, ascites were present in 82.46% of the HCC patients, and portal vein thrombosis was found in 17.54%. Focal lesions were single in 56.14% of cases, affected the right lobe in 56.14% of cases and their size ranged from 3.2 to 14 cm. When miRNAs were studied according to the focal lesion characteristics, it was found that miRNA-23a levels were elevated in patients with focal lesion size equal to or more than 5 cm, in patients with multiple focal lesions; and in Okuda stage III as shown in (Table 3).

Table 3 MicroRNAs levels in relation to tumor characteristics and Okuda staging
Full size table

Receiving operating characteristic (ROC) analysis curves and the corresponding area under the curve were calculated for providing the diagnostic performances of microRNAs and AFP to discriminate HCV-induced HCC patients (Table 4). ROC curve analysis for microRNA-23a expression level represents a good diagnostic performance at a cut-off value of 3.99 (AUC = 0.86), which overtakes AFP, to differentiate healthy control and HCV patients from HCC patients (sensitivity about 80.21% and specificity 85.61%) (Fig. 1). On the other side, the expression levels of miRNA-203, miRNA-100-5p, and miRNA-16 represent poor diagnostic outcomes.

Table 4 Diagnostic performances of miRNAs and AFP among the studied groups
Full size table
Fig. 1
figure 1

ROC curve analysis for miRNA-23a , miRNA-203, miRNA-100-5p and miRNA-16 versus α-fetoprotein

Full size image

The GeneAnalytics disease-related outputs for the analyzed miRNAs set (hsa-miR-100, hsa-miR-16, hsa-miR-203, and hsa-miR-23a) indicated that they matched with ~ 88 diseases, mainly the prostate cancer and including their relations with HCC (Fig. 2). The main pathway related to all the studied MicroRNAs was the SuperPath: miRNAs involved in DNA damage response pathway, while miRNA-23a and miRNA-203 were involved also in interactions between immune cells and MicroRNAs in Tumor Microenvironment pathway (Figs. 3 and 4). The studied miRNAs set and their target genes network were represented in Fig.5.

Fig. 2
figure 2

The Gene-disease relations of the studied miRNAs according to GeneAnalytics (https://geneanalytics.genecards.org)

Full size image
Fig. 3
figure 3

The main pathways related to the four studied miRNAs according to GeneAnalytics (https://geneanalytics.genecards.org)

Full size image
Fig. 4
figure 4

The gene ontology (GO) and pathways for the studied miRNAs. The biological processes and pathways from KEGG Reactome and WikiPathways according to g:Profiler (http://biit.cs.ut.ee/gprofiler/gost)

Full size image
Fig. 5
figure 5

MiRNAs-target gene network analysis. A The studied miRNAs and their target genes network, only the strong validated miRNAs targets were used. B–E The target/target pathway of miR-100, miR-23a, miR-16, and miR-203 respectively. F: miRNAs and their strong validated target gene network with filtering option of minimum two shared targets, representing that target/target pathway of hsa-miR-100 were IGF1R, MTOR and NCOR2; for hsa-miR-16, CDK6 , CCND2, NCOR2, MTOR, and IGF1R; for hsa-miR-203, CCND2, and CDK6, while hsa-miR-23a did not share any common target genes with other miRs according to miRTargetLink 2.0 (https://ccbcompute.cs.uni-saarland.de/mirtargetlink2)

Full size image

Discussion

Several body fluid miRNAs have been identified as cancer biomarkers that exhibit altered expression during tumor initiation and/or progression, aiding in disease diagnosis. However, Up to date, there is no standard reference miRNAs for HCC have been validated. We investigate the usage of a set of miRNAs, involved in the DNA damage response pathway, that could be used as effective biomarkers for HCC patients. Also, highlight reliable relations of these miRs with other laboratory markers and tumor characteristics. Along with highlighting more about these four miRs network.

Currently, numerous miRNAs profiling are employed to characterize cancer’s particular miRNA roles [11]. Dysregulation of miRNAs is considered one of the early events in tumorigenesis [1]. The pathogenesis of HCC comprises a multi-step and/ or stage process, aside from the influence of genetic and environmental factors. Equally, the circulating miRNA avenue has been explored in HCC pathogenesis, as several miRNAs represent their oncogenic and/or tumor suppressor behavior in cancer proliferation, in addition to their modulation of the apoptotic pathway [8, 12].

We have noticed an altered expression of serum miRNA-23a among 84 HCV and 97 HCC patients when compared to healthy individuals. In parallel, Li et al. [13] delineated the upregulation of miRNA-23a in HBV-positive HCC patients and suggested a role of miRNA-23a in the pathogenesis of HCC. In humans, the miR-23a gene is located at chromosome 19 and was transcribed as a part of the miR-23a–27a–24-2 cluster [14]. MicroRNA-23a has been involved in multiple roles including DNA repairing and cell proliferation, the initiation, progression, and metastasis, as well as the treatment response of human cancer [12]. Also, it was found that miRNA-23a down-regulates the expression of interferon regulatory factor-1 in HCC cells [15].

Regarding the role of miRNA-23a in hepatocarcinogenesis, the activation of IL6/Stat3 signaling in the liver mediated the up-regulation of miRNA-23a expression. Then, miRNA-23a directly targets Glucose-6-phosphatase (G6PC) and peroxisome proliferator-activated receptor-gamma coactivator 1-alpha (PGC-1α), to decrease the protein expression and promote carcinogenesis in the liver [16]. Notably, the reduction in G6PC is likely to result in concomitant accumulation of G6P. Alternatively, the tumors could metabolize excess G6P using the hexose monophosphate (HMP) shunt pathway and produce ribose-5-phosphate which is then used in nucleotide synthesis. This enhanced production of the key building block of nucleic acids is probably an important means of meeting the basic requirement for rapid cell division and growth of tumors. Moreover, the increased utilization of glycolytic and HMP shunt pathways in HCC, depending on the extent of accumulation of G6P due to block in gluconeogenesis, may contribute to the survival of the tumor cells under hypoxic conditions [17].

In the current study serum miRNA-203 was down-regulated in HCC, HCV, and liver cirrhosis patients with respect to normal individuals. Uniformly, it was reported that HCC patients with lower levels of miRNA-203 had increased cancer recurrence and shorter survival. This supports the notion that low expression of microRNA-203 is a significant predictor of poor prognosis in HCC patients who underwent LT [18]. Similar results indicated the downregulation of microRNA-203 in HCC patients in comparison to healthy control [19]. As a tumor suppressor miRNA, miRNA203 has been reported to target signal transducer and activator of transcription -1(STAT1) [20]. Additionally, miRNA-203 has been implicated in cell-cycle regulation and induction of apoptosis. The alteration of microRNA-203 expression affects the expression of survivin, where lower expression of microRNA-203 causes a corresponding increase in the expression of survivin and may promote HCC proliferation. The reason for the low expression of microRNA-203 in HCC tissue [21].

He et al. [22] have reported that miR-100-5p was down-regulated in HCC based on a total of 1,258 samples of clinical parameters compared with normal miR-100-5p expression. Likewise, our data of reduced expression of serum miRNA-1005p in HCV, HCC, and liver cirrhosis patients versus healthy individuals. miR-100 downregulation is correlated with progressive pathological features and poor prognosis in patients with HCC [23]. On the contrary, other studies found that circulating microRNA miR-100 was up to 2-fold up-regulated in primary liver nodules. This may indicate that miR-100 exerts an oncogenic function by the subsequent down-regulation of one or more tumor suppressor genes [24]. Serum miR-100-5p is aberrantly expressed and functions in many human cancers by regulating multiple cell processes, such as cell cycle, proliferation, differentiation, migration, invasion, and apoptosis by targeting Polo-like kinase 1 (PLK1), which plays an important role in the initiation, maintenance, and completion of mitosis [25,26,27].

Previous studies have indicated decreased tissue expression levels of microRNA-16 in HCC patients [28, 29]. An initial report describing the potential role of microRNA-16 in chronic lymphoma leukemia11 was followed by studies showing that it is frequently absent or down-regulated in chronic lymphoma leukemia and solid tumors. These data led to the hypothesis that microRNA-16 functions as a tumor suppressor. Proteomic and transcription analyses have revealed several microRNA-16 target genes, including B cell lymphoma 2 (BCL2), myeloid cell leukemia-1 (MCL1), Cyclin D1(CCND), and Wnt Family Member 3A (WNT3A) which are involved in cell growth, the cell cycle, oncogenesis, tumor suppression, and anti-apoptosis. The miR-16 plays an essential role in apoptosis by targeting BCL2 and the caspase signaling pathway [30].

A lot of miRNAs are strongly related to the modulation of HCV infection and replication. The dysregulation of multiple miRNAs due to HCV infection is accomplished through different pathways, including the cell cycle, lipid metabolism, and immune response. Target genes, like PPARG and fibronectin 1 (FN1), stearoyl-CoA desaturase (SCD), and CREB1, were found to be differentially expressed [8]. Many miRNAs patterns shifted to the normal values in the case of viral infection treatment, and miRNA expression in HCV patients treated with sovaldi showed improvement and reached nearly normal values [31]. In accordance with World Health Organization, the elimination of HCV infection is of international interest goal by 2030 [32]. We have noted an accepted performance of microRNA-23a to differentiate HCV patients from healthy controls.

With unsatisfactory results, the routinely used diagnostic tools for HCC detection are serum alpha-fetoprotein and liver ultrasonography (US) [33]. Alpha-fetoprotein can be elevated in other diseases and can be used to follow patients treated for HCV [34]. However, in HCC, the range of specificity and sensitivity of AFP are 76–94% and 39–65%, respectively, depending on the cut-off value [1]. Comparably, we reported a good diagnostic performance for microRNA-23a that surpasses AFP in HCV-related hepatocellular carcinoma patients. As well in this study miR-23a levels were significantly elevated in patients with focal lesions of 5 cm or more in size, patients with multiple focal lesions, and Okuda stage III versus patients with less advanced HCC disease. However, according to The Cancer Genome Atlas (TCGA) database, the higher expression level of miR-23a in HCC predicted a poorer overall survival [16, 35].

MicroRNAs could target various mRNAs via direct binding into their 3'-untranslated region, causing suppression of the gene expression. However, in particular cancers, the cell fate decided by the miRs expression could be in the opposite direction as the expressions of some target proteins were defective [16]. Further, microRNAs may possess the ability to target oncogenes and/or tumor suppressor genes that contribute to its dual activity role as a tumor suppressor and oncomirs through miRNA-long non-coding RNA-transcription factors and protein-protein interaction (lncRNA-TFs-PPI) Crosstalk. In this study, according to the genes/microRNAs network, it was recognized that IGF1R, MTOR, and NCOR2 were the common shared targets for miR-100 and miR-16; for miR-16 and miR-203 the common shared targets were CCND2 and CDK6; no common shared target for miR-100 and miR-203; while miR-23a didn't share any common target genes with other miRs. These testified target genes participated in various biological signaling pathways including cellular proliferation, differentiation, metastasis, invasion, and angiogenesis together with apoptosis.

Conclusions

Nowadays, assorted miRNAs have been addressed the modulation of biological processes in HCC development. The usage of HCC-specific miRNA profiles that are involved in the initiation along with the progression of HCC, could provide effective biomarkers and/or improved therapeutic targets. Herein our results denoted that (1) serum miRNA-23a, miRNA-203, miRNA-100-5p, and miRNA-16 showed altered expression among cirrhotic, HCV, and HCC patients versus the healthy individuals. (2) serum miRNA-203 and miRNA-16 were inversely correlated with miRNA-23a and all miRs exhibited significant correlations with other indices such as AFP, ALT, AST, and albumin. (3) Among the studied microRNAs related to the DNA damage response pathway, miRNA-23a could serve as a screening biomarker with a suitable diagnostic behavior, which overtakes AFP, for early detection of HCC patients (who are previously infected with HCV). Finally, future studies should predict new in silico targets for microRNAs plus consider more HCC-specific microRNAs sets to be validated in diagnosis.

Availability of data and materials

Not applicable.

Abbreviations

MiRNAs:

Micro-ribonucleic acids

HCC:

Hepatocellular carcinoma

HCV:

Hepatitis C virus

LC:

Liver cirrhosis

AFP:

Alpha-fetoprotein

CT:

Computed tomography

INR:

International normalization ratio

SD:

Standard deviation

ROC:

Receiving operating characteristic

GO:

Gene ontology

AST:

Aspartate aminotransferase

ALT:

Alanine aminotransferase

G6PC:

Glucose-6-phosphatase

PGC-1α:

Peroxisome proliferator-activated receptor-gamma coactivator 1-alpha

HMP:

Hexose monophosphate

References

  1. Bai X, Liu Z, Shao X, Wang D, Dong E, Wang Y, Li C (2019) The heterogeneity of plasma miRNA profiles in hepatocellular carcinoma patients and the exploration of diagnostic circulating miRNAs for hepatocellular carcinoma. Plos One 14(2):e0211581

    Article  Google Scholar 

  2. Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J Clin 55(2):74–108. https://doi.org/10.3322/canjclin.55.2.74

    Article  Google Scholar 

  3. Li J, Huang Z, Wei L (2016) Bioinformatics analysis of the gene expression profile of hepatocellular carcinoma: preliminary results. Contemp Oncol/Współczesna Onkologia 20(1):20–27

    Article  Google Scholar 

  4. Thorgeirsson SS, Grisham JW (2002) Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet 31(4):339–346

    Article  Google Scholar 

  5. Chen P, Zhao X, Ma L (2013) Downregulation of microRNA-100 correlates with tumor progression and poor prognosis in hepatocellular carcinoma. Mol Cell Biochem 383(1):49–58

    Article  Google Scholar 

  6. Giordano S, Columbano A (2013) MicroRNAs: new tools for diagnosis, prognosis, and therapy in hepatocellular carcinoma? Hepatology 57(2):840–847

    Article  Google Scholar 

  7. Chen XM (2009) MicroRNA signatures in liver diseases. World J Gastroenterol 15(14):1665

    Article  Google Scholar 

  8. Morishita A, Oura K, Tadokoro T, Fujita K, Tani J, Masaki T (2021) MicroRNAs in the pathogenesis of hepatocellular carcinoma: a review. Cancers 13(3):514

    Article  Google Scholar 

  9. Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams R (1973) Transection of the oesophagus for bleeding oesophageal varices. Br J Surg 60(8):646–649. https://doi.org/10.1002/bjs.1800600817

    Article  Google Scholar 

  10. Okuda K, Ohtsuki T, Obata H, Tomimatsu M, Okazaki N, Hasegawa H, Nakajima Y, & Ohnishi K. (1985). Natural history of hepatocellular carcinoma and prognosis in relation to treatment Study of 850 patients. Cancer 56(4):918–928. https://doi.org/10.1002/1097-0142(19850815)56:4<918::aid-cncr2820560437>3.0.co;2-e

  11. Uzuner E, Ulu GT, Gürler SB, Baran Y (2022) The role of MiRNA in cancer: pathogenesis, diagnosis, and treatment. miRNomics. Humana, New York

    Google Scholar 

  12. Kashyap D, Tuli HS, Garg VK, Goel N, Bishayee A (2018) Oncogenic and tumor-suppressive roles of MicroRNAs with special reference to apoptosis: molecular mechanisms and therapeutic potential. Mol Diagnosis Ther 22(2):179–201

    Article  Google Scholar 

  13. Li LM, Hu ZB, Zhou ZX, Chen X, Liu FY, Zhang JF, Shen HB, Zhang CY, Zen K (2010) Serum microRNA profiles serve as novel biomarkers for HBV infection and diagnosis of HBV-positive hepatocarcinoma. Cancer Res 70(23):9798–9807. https://doi.org/10.1158/0008-5472.CAN-10-1001

    Article  Google Scholar 

  14. Kurkewich JL, Hansen J, Klopfenstein N, Zhang H, Wood C, Boucher A, Dahl R (2017) The miR-23a~ 27a–24-2 microRNA cluster buffers transcription and signaling pathways during hematopoiesis. PLoS Genet 13(7):e1006887

    Article  Google Scholar 

  15. Yan Y, Liang Z, Du Q, Yang M, Geller DA (2016) MicroRNA-23a downregulates the expression of interferon regulatory factor-1 in hepatocellular carcinoma cells. Oncol Rep 36(2):633–640

    Article  Google Scholar 

  16. Wang N, Tan HY, Feng YG, Zhang C, Chen F, Feng Y (2018) microRNA-23a in human cancer: its roles, mechanisms and therapeutic relevance. Cancers 11(1):7

    Article  Google Scholar 

  17. Wang B, Hsu SH, Frankel W, Ghoshal K, Jacob ST (2012) Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. Hepatology 56(1):186–197

    Article  Google Scholar 

  18. Chen HY, Han ZB, Fan JW, Xia J, Wu JY, Qiu GQ, Peng ZH (2012) miR-203 expression predicts outcome after liver transplantation for hepatocellular carcinoma in cirrhotic liver. Med Oncol 29(3):1859–1865

    Article  Google Scholar 

  19. Liu Y, Ren F, Rong M, Luo Y, Dang Y, Chen G (2015) Association between underexpression of microrna-203 and clinicopathological significance in hepatocellular carcinoma tissues. Cancer Cell Int 15(1):1–9

    Article  Google Scholar 

  20. Yang CH, Wang Y, Sims M, Cai C, He P, Yue J, Pfeffer LM (2016) MiRNA203 suppresses the expression of protumorigenic STAT1 in glioblastoma to inhibit tumorigenesis. Oncotarget 7(51):84017

    Article  Google Scholar 

  21. Wei W, Wanjun L, Hui S, Dongyue C, Xinjun Y, Jisheng Z (2013) miR-203 inhibits proliferation of HCC cells by targeting survivin. Cell Biochem Function 31(1):82–85

    Article  Google Scholar 

  22. He QL, Qin SY, Tao L, Ning HJ, Jiang HX (2019) Prognostic value and prospective molecular mechanism of miR 100 5p in hepatocellular carcinoma: a comprehensive study based on 1,258 samples. Oncol Lett 18(6):6126–6142

    Google Scholar 

  23. Song SK, Jung WY, Park SK, Chung CW, Park Y (2019) Significantly different expression levels of microRNAs associated with vascular invasion in hepatocellular carcinoma and their prognostic significance after surgical resection. PLoS One 14(9):e0216847

    Article  Google Scholar 

  24. Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP, Odenthal M (2008) MicroRNA gene expression profile of hepatitis C virus–associated hepatocellular carcinoma. Hepatology 47(4):1223–1232

    Article  Google Scholar 

  25. Jin Y, Wong YS, Goh BK, Chan CY, Cheow PC, Chow PK, Lee CG (2019) Circulating microRNAs as potential diagnostic and prognostic biomarkers in hepatocellular carcinoma. Sci Rep 9(1):1–12

    Article  Google Scholar 

  26. Liu Z, Sun Q, Wang X (2017) PLK1, a potential target for cancer therapy. Transl Oncol 10(1):22–32

    Article  Google Scholar 

  27. Li C, Gao Y, Zhang K, Chen J, Han S, Feng B, Chen L (2015) Multiple roles of microRNA-100 in human cancer and its therapeutic potential. Cell Physiol Biochem 37(6):2143–2159

    Article  Google Scholar 

  28. El-Abd NE, Fawzy NA, El-Sheikh SM, Soliman ME (2015) Circulating miRNA-122, miRNA-199a, and miRNA-16 as biomarkers for early detection of hepatocellular carcinoma in Egyptian patients with chronic hepatitis C virus infection. Mol Diagnosis Ther 19(4):213–220

    Article  Google Scholar 

  29. Zhu B, Wei XX, Wang TB, Zhou YC, Liu AM, Zhang GW (2015) Increased miR-16 expression induced by hepatitis C virus infection promotes liver fibrosis through downregulation of hepatocyte growth factor and Smad7. Arch Virol 160(8):2043–2050

    Article  Google Scholar 

  30. Qu KZ, Zhang K, Li H, Afdhal NH, Albitar M (2011) Circulating microRNAs as biomarkers for hepatocellular carcinoma. J Clin Gastroenterol 45(4):355–360

    Article  Google Scholar 

  31. Beltagy DM, Khedr YI, Sakr AHA (2020) Diagnostic and prognostic roles of miRNA and dielectric parameters in HCV Egyptian patients. J Appl Pharm Sci 10(9):115–121

    Google Scholar 

  32. Krekulova L, Oktabec Z, Riley LW (2022) Key role of multidisciplinary collaboration towards global elimination of HCV infection. Int J Environ Res Public Health 19(7):4158

    Article  Google Scholar 

  33. El-Ahwany E, Mourad L, Zoheiry M, Abu-Taleb H, Hassan M, Atta R, Zada S (2019) MicroRNA-122a as a non-invasive biomarker for HCV genotype 4-related hepatocellular carcinoma in Egyptian patients. Arch Med Sci 15(6):1454–1461

    Article  Google Scholar 

  34. He Y, Lu H, Zhang L (2019) Serum AFP levels in patients suffering from 47 different types of cancers and noncancer diseases. Progress Molecular Biol Transl Sci 162:199–212

    Article  Google Scholar 

  35. Bao L, Zhao J, Dai X, Wang Y, Ma R, Su Y, Cui H, Niu J, Bai S, Xiao Z et al (2014) Correlation between miR-23a and onset of hepatocellular carcinoma. Clin Res Hepatal Gastroenterol 38:318–330

    Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Author information

Authors and Affiliations

  1. Biochemistry Division, Chemistry Department, Faculty of Science, Helwan University, Cairo, Egypt

    Sara M. Abdo, Wafaa Gh. Shousha & Mostafa Mohamed Abdelhamid Ali

  2. Biochemistry Department, National Hepatology and Tropical Medicine Research Institute, Cairo University, Cairo, Egypt

    Amal Ahmed Mohamed

  3. Internal Medicine Department, Faculty of Medicine, Cairo University, Cairo, Egypt

    Mohamed Elshobaky

  4. Internal Medicine department, National Hepatology and Tropical Medicine Research Institute, Cairo, Egypt

    Mohamed Saleh

Authors
  1. Sara M. Abdo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Wafaa Gh. Shousha
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Amal Ahmed Mohamed
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Mohamed Elshobaky
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Mohamed Saleh
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Mostafa Mohamed Abdelhamid Ali
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors contributed to the conceptualization and study design. M.A, A.M, and S.A contributed to the functional evaluation of the study parameters and methodology. W.S, A.M, M.E, and M.S contributed to patients’ recruitment, samples collection, and clinical analysis. S.A performed the bioinformatics analysis. S.A and M.A contributed to data analysis, results interpretation—original draft preparation. S.A writing—review and editing the manuscript. W.S, S.A and A.M. supervision. All authors contributed to revising the manuscript and reviewing the final draft. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Sara M. Abdo.

Ethics declarations

Ethics approval and consent to participate

Informed consents were obtained from participants and approved by the ethical committee for Human Subject Research at National Hepatology and Tropical Medicine Research Institute.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Abdo, S.M., Shousha, W.G., Mohamed, A.A. et al. Bio-diagnostic performances of microRNAs set related to DNA damage response pathway among hepatitis C virus-associated hepatocellular carcinoma patients. J Genet Eng Biotechnol 21, 85 (2023). https://doi.org/10.1186/s43141-023-00537-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43141-023-00537-2

Keywords