A. vasica leaf samples were collected from Poojappura, Thiruvananthapuram, Kerala state, India. This plant material was identified by Dr. Shaji P.K., Scientist, Environmental Resources Research Centre, P.B. No. 1230, P.O. Peroorkada, Thiruvananthapuram, Kerala state, India. All chemicals used in the study were of analytical grade and obtained from Invitrogen, Sigma, and HiMedia Laboratories Private Limited, Mumbai, India. The cell line used in the study was PA 1 (human teratocarcinoma) cell lines which were procured from the National Centre for Cell Science (NCCS), Pune, Maharashtra, India.
Preparation of crude extracts
A. vasica leaf was carefully plucked and washed. The washed leaves were air dried and chopped into small pieces. As the leaves get well dried, the leaves get weighed. Twenty grams of dried leaves was then treated with 70% ethanol kept in a shaker for 24 h. The leaves were squeezed out and air dried. Then, the dried extract was used as the test sample.
Test for alkaloids
Dragendroff’s test
0.25 ml of Dragendroff’s reagent was added to the previous mixture for precipitation, and the precipitate was centrifuged over 5 min at 3000 rpm and then further washed with 0.25 ml of ethanol. The filtrate was discarded and the residue was then treated with 0.25 ml of disodium solution (1% w/v). The brownish black precipitate formed was then centrifuged for 5 min at 3000 rpm. This residue was dissolved in 0.2 ml of concentrated nitric acid, and 0.1 ml was then pipetted out and mixed with 0.5 ml of thiourea solution (3% w/v). The absorbance of this solution was measured at 435 nm using UV–visible spectrophotometer (Agilent, Cary 60) against a blank containing 0.1 ml of concentrated nitric acid and 0.25 ml of thiourea solution (3% w/v), and the values obtained were interpreted using the standard graph of caffeine to get the milligram equivalents of caffeine [20].
Anticancer effect of A. vasica extract against PA 1 cell lines
PA 1 cell lines were grown in Dulbecco’s modified Eagle’s medium supplemented with fetal bovine serum (FBS), penicillin, and streptomycin. The cells were subcultured after trypsinization with 0.25% in 0.5 mM EDTA and were cultured under 5% CO2 at 37 °C.
Dulbecco’s modified Eagle’s medium (DMEM) preparation
DMEM (0.67 g) was suspended in 25 ml tissue culture grade water with constant stirring until the powder was completely dissolved. The water should not be heated, and 0.187 g of NaHCO3 powder was added and stirred until dissolved. The pH was adjusted to 0.2, 0.3 pH units below the desired pH (pH −7.4) using 1 N HCl or 1 N NaOH since the pH tends to rise during filtration. The final volume was made up to 50 ml with tissue culture grade water. The medium was sterilized immediately by filtering through a sterile membrane filter with a porosity of 0.22 μm or less. Positive pressure was used rather than vacuumed to minimize the loss of CO2. Aseptically sterile supplements were added as required, and the desired amount of sterile medium was dispensed into sterile containers. The required medium was then stored at 2 to 8 °C in dark for further use.
Trypsinization
It is the process of using trypsin, a proteolytic enzyme which breaks down proteins, to dissociate adhered cells from the vessels in which they were being cultured. The cell lines were washed with phosphate-buffered saline (PBS). Five hundred microliters of trypsin was added in cultured cell lines for 3 min at 37°C. After disaggregation, the cells were transferred to another flask and supplemented with media.
Subculturing
Subculturing involves transferring a small number of cells into a new vessel. A confluent plate was taken for subculturing. For subculturing, firstly, remove media from the flask. The flask was then washed twice with PBS and then 200 μl of trypsin (0.25% in 0.5 Mm EDTA) was added to the flask. Incubation was done for 3 min. Mixing was done properly with a pipette throughout the incubation time. Fresh media were added to the trypsinized cells and mixing was done. One hundred microliters of suspension was transferred to a 24-well plate. Fresh media were added to both the mother flask and the 24-well plate. It was then plated in a humified incubator at 37 °C with a 5% CO2 incubator.
Sample addition
After attaining sufficient confluency, the cells were trypsinized (500 μl of 0.025% Trypsin in PBS/0.5 mM EDTA solution (Himedia Laboratories, India)) for 2 min and passaged to T flasks in complete aseptic condition. The cells were treated with a sample of different concentrations (100 μg, 50 μg, 25 μg, 12.5 μg, 6.25 μg in 500 μl of 5% DMEM) and were incubated for 24 h before the staining procedure starts.
In vitro cytotoxic effect by sulforhodamine B colorimetric assay
Cell fixation and staining
In the well plate without removing the cell culture, supernatant, 100 μl of cold 10% trichloroacetic acid (TCA), was added and incubated at 4 °C for 1 h. After which, the plates were washed four times with slow running tap water and any excess water was removed using paper towels. The plate was dried using a blow dryer to completely dry them. Once the plates are dry, 100 μl of 0.057% sulforhodamine B (SRB) solution was added to each well. The stain was allowed to be incubated for 30 min followed by briefly rinsing the plate four times with 1% acetic acid to remove any excess unbound dye. This was followed by the addition of 200 μl of 10 mM Tris base solution (pH 10.5) to each well. The plates were then placed in a shaker for 5 min to solubilize the protein-bound dye. The OD was read in a microplate reader at 510 nm.
$$ \mathrm{Percentage}\ \mathrm{viability}\ \left(\%\right)=\frac{\mathrm{Absorbance}\ \mathrm{of}\ \mathrm{test}}{\mathrm{Absorbance}\ \mathrm{of}\ \mathrm{sample}}\times 100 $$
Migration assay
PA1 (ovarian cancer) cell lines were maintained in Dulbecco’s modified Eagle’s medium (Gibco, Invitrogen). The cell line was cultured in a 25-cm tissue culture flask with DMEM supplemented with 10% FBS, l-glutamine, sodium bicarbonate, and antibiotic solution containing penicillin (100 U/ml), streptomycin (100 μg/ml), and amphotericin B (2.5 μg/ml). Cultured cell lines were kept at 37 °C in a humidified 5% CO2 incubator (NBS Eppendorf Germany).
Exponentially growing cells were trypsinized and seeded at a density of 200,000 cells per well into a 12-well plate for 24-h incubation (approximately 90% confluent). The scratch wounds were made by a sterile 1-ml pipette tip through a pre-marked line. After removal of the resulting debris from five lineal scratches, the cell monolayer was subsequently rinsed three times with PBS followed by incubation with LD 50 concentration of extracts for 0 h, 24 h, 48 h, and 72 h.
The wound areas were displayed by taking images just above the interchanges between scratched wound areas’ pre-marked lines, and the effect of the sample on wound closure was determined microscopically at 4× magnification (Olympus CKX41) after incubation. The effect of the sample on wound closure was measured in terms of the area using MRI-ImageJ analysis software.
Gene expression study
PA 1 cells were cultured in a 25-cm2 tissue culture flask with DMEM supplemented with 10% FBS, l-glutamine, sodium bicarbonate (Merck, Germany), and antibiotic solution containing penicillin (100 U/ml), streptomycin (100 μg/ml), and Amphotericin B (2.5 μg/ml). Cultured cell lines were added with LD 50 concentration of the sample and were kept at 37 °C in a humidified CO2 incubator (NBS Eppendorf, Germany). An untreated control was also maintained.
Isolation of total RNA
Total RNA was isolated using the total RNA isolation kit according to the manufacturer’s instruction (Invitrogen product code 10296010). The addition of TRIzol solution causes the disruption of cells and the release of RNA. Chloroform extraction was performed following centrifugation, exclusively in the aqueous phase, whereas proteins are in the interphase and organic phase. On mixing with isopropanol, RNA gets precipitated as a white pellet on the side and bottom of the test tube.
After attaining 70% confluency of cells in a 6-well plate (approximately 4 × 105 cells), the cells were treated with samples and incubated for 24 h. A set of untreated control were also incubated at 37 °C for 24 h in a CO2 incubator. After incubation, DMEM media were removed aseptically and 200 μl of TRIzol reagent was added to the culture well plate and incubated for 5 min. The contents were then transferred to a fresh sterile Eppendorf tube. Two hundred microliters of chloroform was added and shaken vigorously for 15 s and incubated for 2–3 min at room temperature, followed by centrifugation at 1400 rpm for 15 min at 4 °C. The aqueous layer was collected and 500 μl of 100% isopropanol was added. It was incubated for 10 min at room temperature and then centrifuged at 1400 rpm for 15 min at 4 °C. The supernatant was discarded and the pellet thus obtained was washed with 200 μl of 75% ethanol. It was then centrifuged at 14000 rpm for 5 min at 4 °C in a cooling centrifuge (Remi CM12).
The RNA pellet was dried and suspended in TE buffer.
cDNA synthesis and amplification
The cDNA synthesis was performed using Thermo scientific verso cDNA Synthesis kit (Product code AB-1453/A). About 4 μl of 5X cDNA synthesis buffer, 2 μl of dNTP mix, 1 μl of anchored Oligo dT, 1 μl of RT Enhancer, 1 μl of Verso Enzyme Mix, and 5 μl of RNA template (1 mg of total RNA) were added to an RNAse-free tube. Then, the total reaction volume was made up to 20 μl with the addition of sterile distilled water. The solution was mixed by pipetting gently up and down. The thermal cycler (Eppendorf Master Cycler) was programmed to undergo cDNA synthesis. The cDNA synthesis was employed for 30 min at 42 °C and inactivation was employed for 2 min at 95 °C.
The amplification was done using the Thermostatic amplification kit. The following components were added to a new PCR vial in a PCR workstation: for each 50 μl reaction, 25 μl of PCR Master Mix (2X), 2 μl of forward primer (0.1–1.0 μM), 2 μl of reverse primer (0.1–1.0 μM), and 5 μl of template DNA (10 pg–1 μg). The components were made up to 50 μL with sterile distilled water (nuclease free). Initial denaturation was at 95 °C for 3 min, followed by denaturation at 95 °C for 30 s, annealing at Tm for 30s, and extension at 72 °C for 1 min which was repeated for 35 cycles and the final extension at 72 °C for 5 min. After the amplification, the PCR product was separated by agarose gel electrophoresis. The following are the forward sequence (5′–> 3′) and reverse sequence (5′–> 3′) used in the electrophoresis:
|
Human bactin—TCACCCACACTGTGCCCATCTACGA(25)[Tm 66.3],
|
|
CAGCGGAACCGCTCATTGCCAATGG(25) [Tm 67.9]
|
|
Human p 21—GAGGCCGGATGAGTTGGGAGGAG(24)[Tm 69.6],
|
|
CAGCCGGCGTTTGGAGTGGTAGAA(24 [Tm 66.1]
|
|
Human p 53—CCCCTCCTGGCCCCTGTCATCTTC(24) [Tm 69.6],
|
|
GCAGCGCCTCACAACCTCCGTCAT(24) [Tm 67.8]
|
Agarose gel electrophoresis
Agarose gel electrophoresis is a method for separating and visualizing DNA fragments. The fragments are separated by charge and size move through an agarose gel matrix, when subjected to an electric field. The electric field is generated by applying a potential across an electrolyte solution (buffer). When boiled in an aqueous buffer, agar dissolves and upon cooling solidifies to a gel. 1.5% agarose gel was prepared in 1x TE buffer and melted in a hot water bath at 90 °C. Then, the melted agarose was cooled down to 45 °C. Six microliters of 10 mg/ml of ethidium bromide was added and poured into a gel casting apparatus with the gel comb. After setting, the comb was removed from the gel. The electrophoresis buffer was poured into the gel tank and the platform with the gel was placed in it so as to immerse the gel. The gel was loaded with the samples and run at 50 V for 30 min. The stained gel was visualized using a gel documentation system (E gel imager, Invitrogen).
