Chemical agents
Cobalt protoporphyrin (CoPP) was obtained from Sigma Chemical Company (St. Louis, MO, USA) and dissolved in distilled water in dark tubes. Hydrochloric acid (HCl) was purchased from Sigma Aldrich fine chemicals (Cat #, H1758).
Animals
Male Sprague Dawley rats (16 weeks old) weighing between 180 and 200 g acquired from Animal House of Nile Center for Experimental Researches, Mansoura, Egypt, were used. They were housed according to the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978) in stainless steel cages in an artificially illuminated and thermally controlled room (22–25 °C and 12-h light/dark cycle). Rats were fed on a normal laboratory rodent diet, and given water ad libitum for 1 week of acclimation prior to the experimental work. All animals were received human care in compliance with the guidelines of the Animal Care and Use Committee of Damietta University. The experimental protocol was approved by Chemistry Department, Faculty of Science, Damietta University, Egypt.
Operation for induction of HCl-induced acute lung injury (ALI)
In brief, under anesthesia (ketamine (75 mg/kg) and xylazine (10 mg/kg)), the rat was placed in a supine position with the extremities pulled caudally to facilitate exposure of the trachea. Then, trachea was exposed through an anterior neck incision and a direct puncture with a 24-gauge needle on a 1-ml tuberculin syringe is performed two to four tracheal rings below the larynx. HCl was injected into the lung in a volume of 2 ml/kg. After instillation of HCl, the tuberculin syringe was removed. The neck was then repaired with sutures. After 7 days, samples from the lungs were taken, and ALI induction was confirmed.
Isolation and culture of MSCs from bone marrow
In short, the rats were anesthetized using halothane, then the skin was sterilized by ethyl alcohol 70%, and rats’ femurs and tibia were cautiously excised from adherent soft tissues (Fig. 1a–c). After this, bones were kept in 70% ethyl alcohol for 1–2 min, then dipped in a petri dish containing phosphate-buffered saline (Cat no. BE17-516F, Lonza, USA) for washing. Bone ends were cut by sterile scissors with flushing of the bone marrow with Dulbecco’s modified Eagles medium (DMEM) (Cat no. BE12-719F, Lonza, Belgium) enriched with fetal bovine serum (FBS) 10% (Cat no.10270, Gibco, USA) and 1% penicillin strips (10.000 U penicillin–10.000 μg streptomycin/ml) (Cat no. DE17-602E, Lonza, USA). Cells were seeded in 20 ml complete media and incubated at 37 °C in a 5% humidified CO2 incubator (Shel lab, USA) (Fig. 1d–i). One day later, the media were discarded to get rid of the unattached cells. MSCs were differentiated from bone marrow cells by their ability to attach to tissue culture polystyrene flask (75 cm2, Greiner Bio-One). Cells were sub-cultured with using 0.25% trypsin/ethylenediamine-tetraacetic acid (Cat no. BE17-161E, Lonza, Belgium).
Experimental groups
Forty rats were randomly divided into 4 groups of 10 rats in each group:
-
1.
Group I (Control): served as normal control; aspirate normal saline injected into the lung in a volume of 2 ml/kg (negative control).
-
2.
Group II (ALI): aspirate HCl (0.1 N, pH 1.25) injected into the lungs in a volume of 2 ml/kg for one time (positive control).
-
3.
Group III (ALI + BM-MSCs): aspirate HCl, and 1 week later, they were injected intravenously through penile vein with 1 × 106 BM-MSCs/rat for two times; after 1 week of the first dose (1 × 106 BM-MSCs/rat) in 0.2 ml of Dulbecco’s modified Eagles medium (DMEM), rats received the second dose (1 x 106 BM-MSCs/rat) in 0.2 ml DMEM.
-
4.
Group IV (ALI + CoPP): aspirate HCl (0.1 N, pH 1.25), and 1 week later, they were injected intraperitoneally with CoPP (0.5 mg/100 g of body weight) for two times; after 1 week of the first dose (0.5 mg/100 g of body weight), rats received the second dose (0.5 mg/100 g of body weight).
One week later of the last treatment dose, rats in all groups were sacrificed, and the samples were collected.
Collection of blood samples and harvesting of lung tissues
At the end of the experiment, all alive rats were sacrificed after anesthesia (ketamine and xylazine), and blood samples were withdrawn in the EDTA-containing tube for blood cell count and in dry tubes to obtain serum. As well, lung tissues were rapidly harvested, and divided into two parts: one part was placed in formalin (10%) for histopathological examination, and the second part was placed in liquid nitrogen for biochemical analyses of markers of oxidative stress, and for molecular study of the expression of caspase-3 and Bcl2.
Assay of TNF-α in serum
Serum TNF-α was measured via Enzyme-Linked Immunosorbent Assay technique with rat TNF-α kit (eBioscience, Austria) as stated by the instructions of the manufacturer.
Measurement of oxidative stress markers (MDA, SOD, and CAT)
The lung tissues were excised, washed with 0.9% NaCl solution, and some parts were homogenized for assay of catalase (CAT), malondialdehyde (MDA) and superoxide dismutase (SOD) using their kits (Biodiagnostic, Giza, Egypt), and the assay methods were done according to the manufacturer’s instructions. In brief, for determination of MDA level, thiobarbituric acid was used to react with MDA under acidic conditions at 95 °C for 30 min and the absorbance of the developed pink product was measured at 534 nm. Regarding the colorimetric estimation of SOD activity, the test was based on the ability of SOD to inhibit phenazine methosulfate-mediated reduction of nitro blue tetrazolium dye. While, the test for determination of CAT activity was based on that, each unit of CAT decomposes 1 μM of hydrogen peroxide per minute at 25 °C and pH 7. The reaction was stopped after 60 s using CAT inhibitor, and the remaining hydrogen peroxide gave a colored product by reaction with 3,5-Dichloro-2-hydroxybenzene sulfonic acid and 4-aminophenazone in presence of peroxidase. Color intensity was read at 510 nm, and it was inversely proportional to the amount of CAT in the original sample.
Real-time (RT)-PCR for caspase-3 and Bcl2
From 30 mg of lung tissues, total RNA was extracted using the RNeasy® Mini Kit (Cat no. 74106). One microgram of the total RNA was reverse transcribed into cDNA with RT2SensiFAST™ cDNA synthesis kit (Cat. No. BIO-65053). RT-PCR with SYBR Green was used to detect the gene expression of caspase-3 and Bcl2 using the SensiFAST SYBR® No-ROX Kit (Cat. #BIO-65053). Primer sequences of the tested genes are; Bcl2, F: GTACCTGAACCGGCATCT, R: ATCAAACAGAGGTCGCA, caspase-3, F: GGCCGACTTCCTGTATGCTT, F: GGCCGACTTCCTGTATGCTT; R: CGTACAGTTTCAGCATGGCG and housekeeping gene GAPDH; F: TTGTGCAGTGCCAGCCTCGT, R: TGCCGTTGAACTTGCCGTGG. Gene amplification was carried out with an initial denaturation at 95 °C for 2 min, denaturation at 95 °C for 5 s, annealing at 60 °C for 10 s and extension at 72 °C for 5–20 s, and 40 cycles. By the end of the last cycle, temperature was increased to 95 °C to produce a melt curve. The samples were exposed to PIKOREAL96 Real-time thermal cycler (Thermo Fisher, USA); the relative expressions of the target genes were normalized with GAPDH, and calculated by applying the 2−ΔΔCt method.
Histopathological examination
Ordinarily, fixed lung tissues in 10% neutral buffered formalin were processed into paraffin blocks, 3–5 μm sections were made on slides, stained with hematoxylin and eosin dye, and examined under a microscope, and the degree of fibrosis, necrosis, leucocytic infiltration, and alveolar collapse were scored into four grades: no (-), mild (+), moderate (++), and severe (+++).
Statistical analysis
The study results were analyzed using the statistical package for social science, version 17 (SPSS Software, SPSS Inc., Chicago, USA), and expressed as means ± standard deviation (SD). For data with Gaussian distribution, statistical analysis was performed using analysis of variance (One-way ANOVA) followed by Tukey’s multiple-comparison test. For parameters with non-Gaussian distribution, Kruskal–Wallis test was employed followed by Dunnett’s test for multiple comparison. Differences considered significant at p ˂ 0.05.
