Skip to main content

Table 2 Fixed and arbitrary primers used as TRAP markers

From: Suitability of target region amplified polymorphism (TRAP) markers to discern genetic variability in sweet sorghum

  Gene/primer name Gene ID/accession Nucleotide sequence (5′ > 3′) Tm
Lignin-related genes Cinnamoyl coA reductase (CCR) LOC8054741 GTCAGGAACCCAGATGAC 55
Cinnamoyl alcohol dehydrogenase (CAD) LOC110434683 GGGCTTCAAAGTACCCTA 54
Caffeic acid 3-O-methyltransferase (COMT) LOC8070884 CAAGAAGCTCCTCGAGTT 54
Sucrose-related genes Sucrose synthase (susy) Sb01g033060 ATGGTATTCTCCGCAAGTGG 58
Soluble acid invertase (Inv) Sb04g000620 CATCGTTGCAGGGTATCCC 59
Sucrose phosphate synthase (sps) Sb05g007310 GCAAACCTTACGCTGATACTG 56
Arbitrary primer Em1   GACTGCGTACGAATTTGC 49
Em2   GACTGCGTACGAATTGAC 53
Em3   GACTGCGTACGAATTTGA 53
Em4   GACTGCGTACGAATTAAT 52