Skip to main content

Table 2 The simple sequence repeat marker (SSR), their locus name, flanking primer sequence, melting temperature, and fragment sizes of the polymerase chain reaction (PCR) products

From: Exploring genetic variation among Jordanian Solanum lycopersicon L. landraces and their performance under salt stress using SSR markers

SSR name Locus Forward primer 5′-3′ Reverse primer 5′-3′ Tm°C Expected Allele size (bp)
LEaat002 cLES403 gcgaagaagatgagtcta gag cat ag ctctct ccc atgagttctcctctt c 53.55 110
LEaat006 cLET1M11 gcc acg tag tca tga tat aca tag gcc tcg gac aat gaa ttg 45.9 175
LEaat008 THox1 gag tca aca gca tag tggaggagg cgtcgcaattct cag gcatg 51.35 180
LEga003 ND ttcggtttattctgccaa cc gcctgtaggattttcgcc ta 45.65 245
LEta019 Lemsrepr tgtagataacttcctagcgacaat c acggacggatgg aca aat g 47.65 300