Skip to main content

Table 2 List of miRNAs names, miRbase accession numbers, and their mature sequences

From: Spatiotemporal expression pattern of miR-205, miR-26a-5p, miR-17-5p, let-7b-5p, and their target genes during different stages of corpus luteum in Egyptian buffaloes

miR name Accession number Mature miRNA sequence
Let7-b-5p MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU
miR-205 MIMAT0003545 UCCUUCAUUCCACCGGAGUCUG
miR-26a-5p MIMAT0003516 UUCAAGUAAUCCAGGAUAGGCU
miR-17-5p MIMAT0003815 CAAAGUGCUUACAGUGCAGGUAGU