Skip to main content

Table 1 The oligonucleotide primer sets designed for the amplification of the IGF2 in three populations of Japanese quails. The present annotations of this study variants were based on GenBank accession number NC_029520.1

From: Detection of a novel single nucleotide polymorphism in IGF2 gene with a negative impact on egg production and body weight in Japanese quail (Coturnix japonica)

Set Primer code Primer sequence (5′ → 3′) Locus Length Annealing temp.
1 IGF2,exo1-F GGTCCCTCTAGTGACACGC Exon 1 365 bp NA
IGF2,exo1-R CAAAGCGAGGAGAGAGAGCC   
2 IGF2,exo2-F TTGGCATAGCATGAGGTGGG Exon 2 232 bp 61.0 °C
IGF2,exo2-R ATGGCTTCTTTCCCCAGGTG   
3 IGF2,exo3-F CTACCTTGTTGAGGGCTGGG Exon 3 236 bp 60.7 °C
IGF2,exo3-R TGGGTAAAGGGTGACGAAGC   
4 IGF2,exo4-F CCGGCTGGTCACAGTTCATT Exon 4 277 bp 59.8 °C
IGF2,exo4-R GTTGTTCTCCCTTCCCCAGG