Skip to main content

Table 5 List of predicted promoters and other important sequences in upstream of the AKT3 In cow and buffalo

From: The variation in promoter sequences of the Akt3 gene between cow and buffalo revealed different responses against mastitis

No. Predicted promoters Score Range Core promoters (TSS/TATA) GC box CpG island Caat box Species
1 ACCTCAGTGTCAAAAATCTGCCTACTGCTATCTCTGCCTCAAAAACAAAG 0.86 359–409 Two Seven No No No Cow
2 AAAAAATCTACATATAAGTGGACCTGCACAGTTCAAACCCATGTTGTTCA 0.98 589–639      
3 ACGAATTGTATTTAAATCTGGGAATCAGCTTAATCTCTGTAAGCCTCAAT 0.95 2019–2069      
4 AACTACTTAATAAATAGGTTCCGCAGTTTGAAGAGCTAGACTTTTATGTG 0.89 2620–2670      
5 TGTCCCTTGTTATAAGTATGGCCAAAGAAGGTCTAAGTGCAGTTCTTCTA 0.81 291–341 Two Four No No No Buffalo
6 ACCTCAGTGTCAAAAATCTGCCTACTGCCATCTCTGCCTCAAAAACAAAG 0.90 427–477      
7 AAAAAATCTACATATAAGTGGACCTGCACAGTTCAAACCCATGTTTGTTG 0.98 659–709      
8 ACTAATTGTATTTAAATCTGGGAATCAGCTTAATCTCTGTAAGCCTCAAT 0.95 2092–2142      
9 AACTACTTAATAAATAGGTTCCGCAGTTTGAAGAGCTAGACTTTTATGTG 0.89 2690–2740