Skip to main content

Table 1 Details of RFLP products used in the study

From: TLR4 gene polymorphisms in Egyptian vitiligo patients: insights into emerging association with clinical activity, family history, and response to therapy

SNP ID Primers (5′–3′) Restriction enzyme Cat NO RFLP product size
rs10759931 F: ATAACCTCAGTGGGCTCTGG
R: ATGTTCTGGCATCTGGGAAG
KpnI FD0524 AA = 241
AG = 241, 190, 51
GG = 190, 51
rs1927911 F: TCACTTTGCTCAAGGGTCAA
R: AAACCTGCATGCTCTGCAC
StyI ER0411 TT = 203
TC = 203, 178, 25
CC = 178, 25
rs1927914 F: ACAAAATGGTCCCTCACAGC
R: TGGAAAGTAGCAAGTGCAATG
SphI ER0601 TT = 157
TC = 157, 90, 67
CC = 90, 67