Skip to main content

Table 1 Primer pairs used to amplify study genes

From: Assessment of correlation between asthenozoospermia and mitochondrial DNA mutations in Egyptian infertile men

Primer name Genomic location (bp) Sequence (5′-3′) GC content (%) Annealing temp. Product size (bp)
ND1 F
ND1 R
3245-3264
4370-4351
CCCCGGTAATCGCATAAAACT
TTTTGGATTCTCAGGGATGG
45
45
66oC
66oC
1125
ND2 F
ND2 R
4382-4402
5565-5545
CCTATCACACCCCATCCTAAA
TGCAACTTACTGAGGGCTTTG
47
47
69oC
69oC
1183
ATPase6 F
ATPase6 R
8531-8552
9185-9206
AAC GAA AAT CTG TTC GCT TCA
ATG TGT TG T CGT GCA GGT GA
47
47
69oC
69oC
675
  1. F forward primer, R reverse primer, bp base pair position related to the reference human mitochondrial sequence (accession number NC_012920.1)
\