Skip to main content

Table 1 Primers used in this study

From: Simple innovative adaptor to improve genome walking with convenient PCR

Primers name Primer sequence (5′-3′) Location Primer application Tm (°C)
GSP1 GCATAACTTGTGAGATTGAGG map30 gene Reverse primer in the 1st PCR 56.5
AP1 GTAATACGACTCACTATACGGC Adaptor Adaptor primer in the 1st PCR 56.5
GSP2 GGCTAAATGGAAGAGTCG map30 gene Reverse primer in the 2nd PCR 54
AP2 GACTCACTATACGGCTCT Adaptor Adaptor primer in the 2nd PCR 54
F helper GCATGGTGAAATGCTTACTAC map30 gene Forward primer in the 3rd PCR 50.5