Skip to main content

Table 2 List of ISSR, SRAP and ISTR primer combinations obtained from the current investigation

From: A systematic revision of Capparaceae and Cleomaceae in Egypt: an evaluation of the generic delimitations of Capparis and Cleome using ecological and genetic diversity

Primer name Sequence Primer name Sequence
HB1 (CAA)5 HB 12 (CAC)3 GC
HB 2 (CAG) 5 HB 13 (GAG)3 GC
HB 4 (GACA) 4 HB 15 (GTG) 3 GC
HB 8 (GA)6 GG 807 (AG)8 T
HB 9 (GT) 6 GG 814 (CT) 8TG
HB 10 (GA) 6 CC 844A (CT)8 AC
HB 11 (GT) 6 CC 844B (CT) 8 GC
17899B (CA) 6 GG   
Marker type Marker Name Forward primer Reverse primer Marker Name Forward primer Reverse primer
SRAP Em 1R/DN 6 F GACTGCGTACGAATTAAT /TGAGTCCAAACCGGTAA Em 10 R/DN 8 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGTGC
Em 1R/DN 7 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTCC Em 10 R/DN 9 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGTCA
Em 1R/DN 8 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTGC Em 10 R/DN 10 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGGCT
Em 1R/DN 9 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTCA Em 10 R/DN 12 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGTGT
Em 1R/DN 10 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGGCT Em 12 R/DN 11 F GACTGCGTACGAATTCTC TGAGTCCAAACCGGTAG
Em 1R/DN 11 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTAG Em 15 R/DN 6 F GACTGCGTACGAATTGTC TGAGTCCAAACCGGTAA
Em 1R/DN 12 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTGT Em 15 R/DN 8 F GACTGCGTACGAATTGTC TGAGTCCAAACCGGTGC
Em 1R/DN 6 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTAA Em 15 R/DN 9 F GACTGCGTACGAATTGTC TGAGTCCAAACCGGTCA
Em 1R/DN 7 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTCC Em 15 R/DN 10 F GACTGCGTACGAATTGTC TGAGTCCAAACCGGGCT
Em 1R/DN 8 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTGC Em 15 R/DN 12 F GACTGCGTACGAATTGTC TGAGTCCAAACCGGTGT
Em 1R/DN 9 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTCA Em 18 R/DN 12 F GACTGCGTACGAATTGAG TGAGTCCAAACCGGTGT
Em 1R/DN 10 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGGCT Em 20 R/DN 6 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTAA
Em 1R/DN 11 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTAG Em 20 R/DN 7 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTCC
Em 1R/DN 12 F GACTGCGTACGAATTAAT TGAGTCCAAACCGGTGT Em 20 R/DN 8 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTGC
Em 6 R/DN 7 F GACTGCGTACGAATTGCA TGAGTCCAAACCGGTCC Em 20 R/DN 9 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTCA
Em 8 R/DN 8 F GACTGCGTACGAATTCTG TGAGTCCAAACCGGTGC Em 20 R/DN 10 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGGCT
Em 9 R/DN 9 F GACTGCGTACGAATTCAG TGAGTCCAAACCGGTCA Em 20 R/DN 11 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTAG
Em 10 R/DN 6 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGTAA Em 20 R/DN 12 F GACTGCGTACGAATTGCC TGAGTCCAAACCGGTGT
Em 10 R/DN 7 F GACTGCGTACGAATTCAT TGAGTCCAAACCGGTCC    
ISTR F1/B2 AGGAGGTGAATACCTTAG GGATATCCTATGAATCAAGC F3/B2 GTCGACATGCCATCTTTC GGATATCCTATGAATCAAGC
F1/B3 AGGAGGTGAATACCTTAG ATTCCCATCTGCACCAAT F3/B3 GTCGACATGCCATCTTTC ATTCCCATCTGCACCAAT
F3/B5 GTCGACATGCCATCTTTC CTTCTGTGAAAGTCCTAG F3/B6 GTCGACATGCCATCTTTC ATATATGGACTTAAGCAAGCA
F3/B8 GTCGACATGCCATCTTTC CCTCCTTATTGGGAATGATAT F7/B3 TGCTAGGACTTTCACAGA ATTCCCATCTGCACCAAT
F3/B10 GTCGACATGCCATCTTTC GACCCTTTTGAAAACACATG F7/B6 TGCTAGGACTTTCACAGA ATATATGGACTTAAGCAAGCA
F5/B7 ATATATGGACTTAAGCAAGC GGAATATCATTCCCAATAAG F9/B2 ATATGGACTTAAGCAAGCCA GGATATCCTATGAATCAAGC
F5/B8 ATATATGGACTTAAGCAAGC CCTCCTTATTGGGAATGATAT F9/B3 ATATGGACTTAAGCAAGCCA ATTCCCATCTGCACCAAT
F10/B6 GGAATATCATTCCCAATAAG ATATATGGACTTAAGCAAGCA F9/B6 ATATGGACTTAAGCAAGCCA ATATATGGACTTAAGCAAGCA
F1/B8 AGGAGGTGAATACCTTAG CCTCCTTATTGGGAATGATAT F9/B10 ATATGGACTTAAGCAAGCCA GACCCTTTTGAAAACACATG