Skip to main content

Table 1 Oligonucleotide primers and fluorescent label of loci used in the study

From: Genetic analysis of X-chromosomal short tandem repeat (X-STR) frequencies in Arab Iraqi male population

Target Primer sequence fluorescent label (5′-3′) Product size bp Ta°C Reference
DXS7424 F:5′AACACAGGAAGACCCCATC 3′
FAM
R:3′GGCTAAGAAGAATCCCGCACA5′
76–100 58 [14]
HPRTB F:5′TCTCTATTTCCATCTCTGTCTCC3′
FAM
R:3′TCACCCCTGTCTATGGTCTCG 5′
144–176 58
DXS8377 F: ′5CACTTCATGGCTTACCACAG3′
FAM
R:3′GACCTTTGGAAAGCTAGTGT 5′
201–261 58 [15]
GATA31E08 F:5′CAGAGCTGGTGATGATAGATGA3′
VIC
R:3′GCTCACTTTTATGTGTGTATG TATCTCC5′
101–129 58 [16]
DXS7423 F:5′GTCTTCCTGTCATCTCCCAAC 3′
VIC
R:3′TAGCTTAGCGCCTGGCACAT A5′
179–191 58
DXS8378 F:5′CACAGGAGGTTTGACCTGTT3′
VIC
R:3′AACTGAGATGGTGCCACTGA 5′
198–222 58 [14]
DXS9895 F: 5′TTGGGTGGGGACACAGAG3′
NED
R:3′CCTGGCTCAAGGAATTACAA 5′
139–163 58 [16]
DXS10074 F 5′ACTTCCTACTGCCCCACCTT3′
NED
R:3′GTTTCCCCTCAGAGAGCTGA CACA5′
203–227 58 [17]
DXS6809 F:5'TGAACCTTCCTAGCTCAGGA3'
NED
R:3′TCTGGAGAATCCAATTTTGC5′
231–278 58 [16]
DXS7133 F5′AGCTTCCTTAGATGGCATTCA3′
PET
R:3′GTTTTTAACGGTGTTCATGCT T5′
80–100 58
DXS101 F:5′ACTCTAAATCAGTCCAAATATCT3′
PET
R:3′AAATCACTCCATGGCACATG TAT5'
197–230 58
DXS6807 F:5′GAGCAATGATCTCATTTGCA3′
PET
R:3′AAGTAAACATGTATAGGAAA AAGCT5′
250–270 58 [18].
  1. Ta(C°) annealing temp