Skip to main content

Table 1 List of primers sequences and restriction enzymes

From: Genetic structure of some candidate genes of repeat breeder syndrome in Egyptian buffaloes

Gene name Studied part Primers Annealing temp Characterization Reference
Leptin Exon 2 partial sequence ATGCGCTGTGGACCCCTGTATC
TGGTGTCATCCTGGACCTTCC
52°C RFLP-Kpn2I Buchanan et al. [27]
Leptin receptor Exon 2 ACTACAGATGCTCTACTTTGG
TGCTCCTCCTCAGTTT
51°C sequence Almeida et al. [28]
BMP4 Intron 5 and exon 6 TGGAACAGGAGAATGAGATAT
TTATTTTGCGAATCCTGAGT
55°C RFLP-Hinf1 Ortiz et al. [24]