Skip to main content

Table 2 SSR loci primers used on sweet orange genotype studied. The primer sequences are based on Liu et al. [16]

From: A new insight on genetic diversity of sweet oranges: CAPs-SSR and SSR markers

Sequence Repeat motif Length Forward (5′-3′) Reverse (5′-3′) GC TM
TAA27 TAA 21 GGATGAAAAATGCTCAAAATG TAGTACCCACAGGGAAGAGAGC 57% 55.69–64.21 °C
CAC15 CAC 22 TAAATCTCCACTCTGCAAAAGC GATAGGAAGCGTCGTAGACCC 40% 53.11–61.76 °C
AG14 AG 20 AAAGGGAAAGCCCTAATCTCA CTTCCTCTTGCGGAGTGTTC 55% 54.25–62.72 °C
CAT01 CAT 20 GCTTTCGATCCCTCCACATA GATCCCTACAATCCTTGGTCC 50% 52.73–61.33 °C
TC26 TC 20 CTTCCTCTTGCGGAGTGTTC GAGGGAAAGCCCTAATCTCA 50% 51.87–60.61 °C