Skip to main content

Table 1 List of genes with primer sequences, size, and accession numbers

From: Correlation of preferentially expressed antigen of melanoma (PRAME) gene expression with clinical characteristics in acute leukemia patients

Sl. no Gene name Sequence (5′–3′) Size (bp) Accession No. (NCBI gene ID)
1 Beta-actin (β-actin) F: TCCTTCCTGGGCATGGAG 207 NM_001101.2
R: AGGAGGAGCAATGATCTTGATCTT
2 PRAME F: TGAAAATGGTGCAGCTGG 154 Reference No- [13]
R: CGGGGAAATGTAGGAAGA