Skip to main content

Table 2 QGRS sequences

From: A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria

Aptamer QGRS sequences overlaps not included length G-score
S15K3 GGTGCGGTACCCGGGGATGCGG 22 18
S15K4 GGGCCCACAGGGTACGCGTCTGCGGCTGG 29 12
S15K6 GGGAGTGCGCTGGGCATGTGGGCGCCGGGG 30 39
S15K13 GGTTGGTATTGAAAACGCGGCCGCGG 26 11
S15K15 - - -
S15K20 GGCGCTGCCGGTGTGGTCGCGG 221 17