Skip to main content

Table 1 Primer sets procured from Xcelris, India

From: In silico structural and functional characterization of Antheraea mylitta cocoonase

Name Primers Annealing temp. (°C) Amplicon size (bp)
ApCoc1 TACTATTGGCTTGTGCCATTTTT (Forward) 49.6 769
ATATACACCAGGGTTTCCAGGAC (Reverse)
ApCoc2 AGTCAAAGAACGAATGATGTTGGG (Forward) 50.5 686
CGGAGTGCTGTGACATTTGC (Reverse)
ApCoc3 ACTATTGGCTTGTGCCATTTTT (Forward) 48.5 746
GTATCCAACCACGGAGTGTC (Reverse)
ApCoc4 TTTACTATTGGCTTGTGCCATTT (Forward) 45.8 771
TTTTAAACTCCTGCAGTCTTTCG (Reverse)