Skip to main content

Table 4 siRNAs designed in the present study for the “S” gene and various parameters

From: Design of siRNA molecules for silencing of membrane glycoprotein, nucleocapsid phosphoprotein, and surface glycoprotein genes of SARS-CoV2

siRNA Conserved region ID Target sequence (21 + 2 nt) siRNA sequence antisense/guide) 21 nt Sense/passenger (19 nt) SMEpred (efficacy) Free energy of binding Free energy of folding Whole dG (kcal/mol) GC content (%) siRNA scales RNAxs (position) OligoWalk (probability value) Guide (Tm) Passenger (Tm) siDirect (position) i-Score
S10.3 10 AAGGAATCTATCAAACTTCTAAC UAGAAGUUUGAUAGAUUCCuu GGAAUCUAUCAAACUUCUA 100.7 −30.6 1.5 −31.9 31.6 7 67 0.90315 17.7 16 47–69 79
S28.5 28 AGCTGTTGAACAAGACAAAAACA UUUUUGUCUUGUUCAACAGcu CUGUUGAACAAGACAAAAA 97.3 −31.2 1.6 −30.3 31.6 11 113 0.893136 14.9 20.5 93–115 72.7