Skip to main content

Table 3 siRNAs designed in the present study for the “N” gene and various parameters

From: Design of siRNA molecules for silencing of membrane glycoprotein, nucleocapsid phosphoprotein, and surface glycoprotein genes of SARS-CoV2

siRNA Conserved region ID Target sequence (21 + 2 nt) siRNA sequence (antisense/guide) 21 nt Sense/passenger (19 nt) SMEpred (efficacy) Free energy of binding Free energy of folding Whole dG (kcal/mol) GC content (%) siRNA scales RNAxs (position) OligoWalk (probability value) Guide (Tm) Passenger (Tm) Position (siDirect) i-Score
N11.2 11 ATGACAAAGATCCAAATTTCAAA UGAAAUUUGGAUCUUUGUCau GACAAAGAUCCAAAUUUCA 94.5 −30 1.7 −31.1 31.6 15 58 0.78544 0.4 19.2 38–60 73.6
N10.1 10 GGCCAAACTGTCACTAAGAAATC UUUCUUAGUGACAGUUUGGcc CCAAACUGUCACUAAGAAA 87.1 −35.8 1.8 −33.1 36.8 17 43 0.923617 11.7 16.7 23–45 74.5