Skip to main content

Table 2 siRNAs designed in the present study for the “M” gene and various parameters

From: Design of siRNA molecules for silencing of membrane glycoprotein, nucleocapsid phosphoprotein, and surface glycoprotein genes of SARS-CoV2

siRNA Conserved region ID Target sequence (21 + 2 nt) siRNA sequence (antisense/guide) 21 nt Sense/passenger (19 nt) SMEpred (efficacy) Free energy of binding Free energy of folding Whole dG (kcal/mol) GC content (%) siRNA scales RNAxs (position) OligoWalk (probability value) Guide (Tm) Passenger (Tm) Position (siDirect) i-Score
M8.5 8 CACGAACGCTTTCTTATTACAAA UGUAAUAAGAAAGCGUUCGug CGAACGCUUUCUUAUUACA 99.5 −32.4 1.7 −31.9 36.8 4 118/(98–120) 0.808041     75.2
M8.3 8 ATCACGAACGCTTTCTTATTACA UAAUAAGAAAGCGUUCGUGau CACGAACGCUUUCUUAUUA 93.3 −30.8 36.8 8 116/(96–118) 0.880858     70.3