Skip to main content

Table 1 qRT-PCR reaction system: primers used to amplify mRNA

From: The NDUFV2 gene silencing inhibits the proliferation of two drug-resistant cancer cell lines

Primer HMBS NDUFV2
Upstream sequence CCCTGGAGAAGAATGAAGTGGA TTTAGGGGCCTGTGTGAACG
Downstream sequence TTTGGGTGAAAGACAACAGCATC GAGAAGCGTCCACTCCTTGG