Skip to main content

Table 1 List of primers used

From: Spatiotemporal expression pattern of miR-205, miR-26a-5p, miR-17-5p, let-7b-5p, and their target genes during different stages of corpus luteum in Egyptian buffaloes

Gene Sequence 5′ to 3′ Accession no. Product size (bp) Annealing, °C
AMH F: CTGCTTCACACGAAAGACCC
R: GCGTGAGAGTCTCCAGGAAG
XM_006047815.1 170 54
PLA2G3 F: CTGTGTGGAGTGGTACTGGT
R: ACTTCTGAGGATGCTGTATCA
XM_006051028.1 176 50
CASP3 F: GACTGTGGTATTGAGACAGACA
R: CGTACTTTTTCAGCATCTCAC
XM_006075118.1 175 50
PCNA F: GTAGTAAAGATGCCTTCTGGTG
R: AAGAAGTTCAGGTACCTCAGTG
XM_006047748.1 239 50
LHCGR F: CATCACCTATGCTATTCAACTG
R: TGGTTAAGATGTAGACCTGTGA
NM_174381.1 191 50
GAPDH F: CTACATGGTCTACATGTTCCAG
R: CCTTCTCCATGGTAGTGAAGA
XM_006065800.1 200 50
18S F: CGCAGCTAGGAATAATGGAA
R: TCTGATCGTCTTCGAACCTC
NR_036642 217 55
ACTB F: GGCATTCACGAAACTACCTT
R: CAATCCACACGGAGTACTTG
NM_001290932.1 198 55