Skip to main content

Table 6 List of primers used in the experiment

From: The variation in promoter sequences of the Akt3 gene between cow and buffalo revealed different responses against mastitis

No. Primers Temperature
1 ATTGGTACCCTCTGGTGGCTTTTTATCTTTGCT
GGCAGATCTTCACAATGGTAACATCGCTCA
60.2
2 ATTGGTACC CGAAATGTAATCGTGCCCTC
GGCAGATCTTCACAATGGTAACATCGCTCA
59.0
3 ATTGGTACCACCTTTTCCCACTTTCATCTTC
GGCAGATCTTCACAATGGTAACATCGCTCA
60.0
4 ATTGGTACC CCTTTCACCTCAAACACCCAT
GGCAGATCTTCACAATGGTAACATCGCTCA
59.2
5 GGCGGTACCCTTTCTTCAATACTTCCTTCCAG
GGCAGATCTTCACAATGGTAACATCGCTCA
60.0
6 ATTGGTACCCAAGGCAGAGTAAGCATACATAAA
GGCAGATCTTCACAATGGTAACATCGCTCA
60.2
7 ATTGGTACCATCTGCGAAATGTAATCGTGCC
GGCAGATCTTCACAATGGTAACATCGCTCA
59.6
8 ATTGGTACCAAAGAATGTGGGCTTCAGAATCAGA
GGCAGATCTTCACAATGGTAACATCGCTCA
60.4