Skip to main content

Table 2 List of primers used for mRNA expression

From: The variation in promoter sequences of the Akt3 gene between cow and buffalo revealed different responses against mastitis

No. Primers Temperature
1 AGGTTGGGTTCAGAAGAGGG
AAGTTGTTGAGGGGATAAGG
58.0
2 TTGTGAAAGAAGGTTGGGTT
CTGAAAAGTTGTTGAGGGGATA
59.0
3 GAAAAATATGATGAGGACGG
TGTAAGAGTTAGGACTGCTGTG
60.0