Skip to main content

Table 2 Nucleotide sequences of primers used in PCR

From: Plant regeneration and transformation of Trachyspermum ammi using Agrobacterium tumefaciens and zygotic embryos

Gene Primer sequences
5′ to 3′
Gus F: 5′ ACCTCGCATTACCCTTACGCTGAA 3′
R: 5′ AATCGCCGCTTTGGACATACC 3′
Tps2 F: 5′ ACTCGTCTCCGTCCTATC 3′
R: 5′ CGTCCTTCGTATTCTCAC 3′
nptII F: 5′ GTCATCTCACCTTGCTCCTGC 3′
R: 5′ AAGAAGGCGATAGAAGGCG 3′
Vir G F: 5′ ATGATTGTACATCCTTCACG 3′
R: 5′ TGCTGTTTTTATCAGTTGAG 3′