Skip to main content

Table 1 Microsatellite loci used, annealing temperatures, primers sequence, gene bank accession numbers, and reported type and size range with jumbo and grey Japanese quail strains

From: Genetic and physiological variation in two strains of Japanese quail

Locus name AT. (°C) Primers sequence Chromosome no. Gene Bank accession no. Repeat type Band Size (bp)
GUJ0013 55 ACCAAACCCGAGATCCGACA
AGCGTTCGCGTTCCTCTTTC
GGA1 AB035823 (CA)10 80–100
GUJ0021 62 GAGCATTTCTAGTCTGTCTC
GATCAATACACAGGCTAAGG
CJA06 AB035831 (CA)11 155–188
GUJ0028 54.6 TGAACAAAGCAGAAAGGAGC
CCTTACCTACATGAAACGTC
QL08 AB035838 (CA)9 104–167
GUJ0048 55 AACGCATACAACTGACTGGG
GGATAGCATTTCAGTCACGG
CJA01 AB035858 (CA)14 52–94
GUJ0051 55 CCTTAACCACTCCTACTGAC
TTTTGTAAGTGGCCCCGTAC
CJA01 AB063119 (CA)10 45–65
GUJ0052 55 AAACTACCGATGTAAGTAAG
ATGAGATATATAAGGAACCC
CJA01 AB063120 (CA)12 55–151
GUJ0053 64 GCTGGAGTTTTACATGCACG
TGGATTATGATGCTGACATAAG
Unknown AB063121 (CA)19 177–215
GUJ0054 55 GTGTTCTCTCACTCCCCAAT
ATGTGAGCAATTGGGACTG
CJA06 AB063122 (CA)7 54–103
GUJ0057 62 GGAATGGAAAATATGAGAGC
CAGGTGTTAAAGTCCAATGT
CJA03 AB063125 (CA)12 130–250
GUJ0087 55 CATGCCGGCTGCTATGACAG
AAGTGCAGGGAGCGAGGAAG
CJA06 AB063155 (CT)12AA(CA)11 154–198
GUJ0099 55 CTCTTATCCATCCTTCCTTC
TTTTAAGTTTCCCCAGGCAG
CJA03 AB063167 (CA)16GA(CA)5(TA)7 35–77
UBC001 48 TCTCTAAAATCCAGCCCTAA
AGCTCCTTGTACCCTATTGC
1 AF121113 (CAG)3 N9(CA)3TA(CA)5 475–610
UBC002 50 CAGCCAATAGGGATAAAAGC
CTGTAGATGCCAAGGAGTGC
6 AF121114 (AT)3 T(CT)11A(AC)7 190–253
UBC005 57 GGAACATGTAGACAAAAGC
AGTAGTCCATTTCCACAGCCA
3 AF121117 (AC)9 100–181
\