Skip to main content

Table 1 Specific oligonucleotide primers sequences (Metabion; Germany)

From: Enhancement of the antibacterial potential of plantaricin by incorporation into silver nanoparticles

Primer Target gene Primer sequence Amplified product Reference
Lb. plantarum recA gene F: 5 CAGAATTGAGCTGGTGGTGG3-
R: 5-TGTTACTTTCGCAACCAGAT3
210 bp [26]
Bacteriocin gene Pln EF F: GGCATAGTTAAAATTCCCCCC
R:CAGGTTGCCGCAAAAAAAG
428 bp [27]
\