Skip to main content

Table 2 Putative miRNAs targeted the transcripts of ethylene biosynthesis genes

From: Insights into the genes involved in the ethylene biosynthesis pathway in Arabidopsis thaliana and Oryza sativa

miRNA ID Target ID miRNA sequence (3-5) Target position Expectation Inhibition
ath-miR843 AT1G02500 (SAM1) AGGUUACUUCGAGCUGGAUUU 1333–1353 3 Cleavage
ath-miR843 AT2G22810 (ACS4) AGGUUACUUCGAGCUGGAUUU 675–694 2.5 Cleavage
ath-miR159a AT2G22810 (ACS4) AUCUCGAGGGAAGUUAGGUUU 437–457 3 Cleavage
ath-miR159a AT4G37770 (ACS8) UCCUCGAGGGAAGUUAGGUUU 458–478 1.5 Cleavage
ath-miR3933 AT1G77330 (ACO5) GGCUCAGCAGUAAAACGAAGA 739–759 2.5 Cleavage
osa-miR1858 LOC_Os01g22010 (SAM) CGGGGUGAGGCAGGAGGAGAG 567–587 3 Cleavage
osa-miR1858 LOC_Os05g04510 (SAM) CGGGGUGAGGCAGGAGGAGAG 570–590 3 Cleavage
osa-miR5809 LOC_Os05g05680 (ACO) CGACACCAGCGGCCGCUGCU 802–821 3 Cleavage
osa-miR531a LOC_Os11g08380 (ACO) UACCGCCGUGCGUCGGGGCCGCUC 900–923 3 Cleavage
osa-miR531b LOC_Os11g08380 (ACO) GCCGUGCGUCGGGGCCGCUC 904–923 3 Cleavage