Skip to main content

Table 2 Characterized SSR primers with their diversity characteristics. PN series primers are newly developed primers in the present study

From: Analysis of genetic diversity and population structure in Asparagus species using SSR markers

Primer ID Primer sequence (5´–3´) Repeat motif Ta (°C) No. of bands Size range (bp) PIC Ho He
SSR-13 F:CGACCAGAGAAGGAAGGAG
R:CAACCACGCTCATAAGAAC
(TC)11 49 4 590–680 0.630 0.479 0.682
SSR-15 F:ATGATCCCTGAAGTTGTTG
R:GTTCCTCTACCAGCCAAG
(TC)20(TG)10 47 8 90–200 0.628 0.646 0.668
SSR-22 F:TAAGCAACTCACTCACTATG
R:TGATGTGTGAAGGAGGAGG
(CACT)5 48 7 350–470 0.790 0.708 0.820
SSR-37 F:TATGTTCCTTGCTTCCATG
R:CGGTAGAAGTGATTGTGTAT
(AG)11 47 7 140–270 0.771 0.750 0.807
SSR-40 F:GCATATTTCTACTACGCCTCC
R:CAAACTAACCCTCAATCACTCG
(ATAGA)5 52 5 400–440 0.576 0.167 0.622
SSR-43 F:CTTGATGGAGCTGGTCTTGT
R:TTCTCCACCCTCAATCTCAATAC
(AG)9 52 3 250–400 0.630 0.458 0.696
SSR-56 F:GCTGCTAAGGGATATAGTGCCA
R:TATGGTTGCAGAGGATAGGT
(GACAAT)6 50 5 180–350 0.760 0.542 0.800
SSR-63 F:TTAAGTCAGGTGGTGCTCTC
R:CTGGATTAGTGGTTGATGATG
(TTGAAAA)54 50 3 140–200 0.585 0.083 0.658
SSR-69 F:GGCTAATTGTGTTGGGAATCG
R:CCAACTAATCTACTGACACACG
(AG)14 52 5 220–400 0.699 0.583 0.750
SSR-77 F:GGCCTGCATGTTCTTTATATC
R:GCTCATTCTCATCCACTCAT
(CA)12 50 6 230–300 0.679 0.333 0.726
SSR-83 F:GAGTTGAGGCGAGGGACAT
R:GTTACTTTCGAGGAGGCCA
(AC)10 51 4 180–400 0.644 0.208 0.702
PN3 F: CCCCTCAAAATCTAACTTCTC
R:CAGTTCTACATGCAGATGACC
(GGC)7 50 4 125–160 0.389 0.208 0.411
PN4 F:CCCCCTCTCTAGATATCGTC
R:AAGAAGTCGAGGTTTCTGATG
(CT) 12 50 6 500–620 0.743 0.667 0.785
PN9 F:TGAATCTATGGATACCGAAAA R:ATAAAGCCAGACACATCAACA (TC) 12 47 5 320–450 0.767 0.646 0.804
PN10 F:GATTTTTCTGCCTTCTCTACC
R:ATTTTGCCCTTCCATTATCT
(CT)8 46 5 180–230 0.616 0.625 0.664
PN12 F:TGGCTTTTGTGTTGAAATACT
R:ACAAATTTTCCCCAATTTTC
(GGT)6 44 5 280–450 0.641 0.729 0.702
PN13 F:TTTCTATTGCCGGAGACTAA
R:GCAACTATTCTTCATCCACAG
(GAT)6 48 6 140–170 0.782 0.938 0.817
PN14 F:GACATCGATCTCCTTCTTCTT
R:AATCCTGGCATCTGAGGT
(TC)9 48 5 400–600 0.763 0.333 0.802
PN15 F:CCGCTCAGAACTTGTTATTAT
R:AATTACAAATAGCCTCTTTTGG
(TA)16 47 5 400–600 0.710 0.333 0.756
AGA1 F: CCGGTGCTTTGATTACTGCT
R: GATCATCATCTTGCGCATTG
(AGA)11 50 3 480–600 0.536 0.479 0.598
AG5 F: GATTAATAAAGCGCCGCTGA
R:ACATAAGCCCATACTTGCGG
(TC)18 50 5 490–640 0.784 0.396 0.820
TC1 F: AGGTGGAGAACAAATGGCTG
R:CGAGCTCAATTGAAATCCATAA
(TC)12 49 5 150–250 0.789 0.479 0.824
TC3 F: CACCATTTCAAATCCCCACT
R:GAGGCTAGAGCTCCGCTCAT
(AG)13 50 7 150–350 0.775 0.750 0.809
TC8 F: GGCTAGCCGAAAGAATCTCC
R:TCTTCCTCCTCCTCCTCCTC
(CT)10 54 4 130–160 0.726 0.354 0.773
Mean     5   0.683 0.495 0.729
  1. Ta annealing temperature, PIC polymorphism information content, bp base pair, He expected heterozygosity, Ho observed heterozygosity