Skip to main content

Table 1 Description of forward (5′-3′) and reverse (3′-5′) primer sets were designed as two forward specific primers with different 3′ ends (original and underlined substitute nucleotide) and one reverse primer site except for position 1481, two specific reverse and one forward

From: Light/heat effects on RNA editing in chloroplast NADH-plastoquinone oxidoreductase subunit 2 (ndhB) gene of Calotropis (Calotropis procera)

Position F 5′ → 3′ R 3′ → 5′
467 TAACTATCTTTGTAGCTCT ATGAAATATTTACTCATGGG
TAACTATCTTTGTAGCTCC
586 AAGCTCTTCTATTCTGGTTT TCTCTCCCCCGGATAAACCAT
AAGCTCTTCTATTCTGGTTC
611 TTCTCTTGGCTATATGGTTT CTGGAGTGGGAGATCCTTCG
TTCTCTTGGCTATATGGTTC
737 ATTGGGTTCAAGCTTTCCCT TGGAGTGGGAGATCCTTCGT
ATTGGGTTCAAGCTTTCCCC
747 AGCTTTCCCCAGCCCCTTCT GGCATCTTCTTCTGGAAATC
AGCTTTCCCCAGCCCCTTCC
830 ACTTCGAAAGTAGCTGCTTT AACGTATGCTTGCATATTCG
ACTTCGAAAGTAGCTGCTTC
1481 CGAAACCAAGAAATAACCCCT CGGGTTCATTGATATTCCTA
CGGGTTCATTGATATTCCTG
Actin TGGTCGTCCAAGACACACTG CTCTTCAGGGGCAACACGAA