Skip to main content

Table 2 Sequences of LAMP primers for amplification of the syrD DNA from Psy

From: Loop-mediated isothermal amplification: a rapid molecular technique for early diagnosis of Pseudomonas syringae pv. syringae of stone fruits

Primer Length (bp) Sequence
F3 21 5′AAACCAAGCAAGAGAAGAAGG3′
B3 21 5′GGCAATACCGAACAGGAACAC3′
FIB 46 5′CAGGGATGGCTGCTCCATAACCAGACCGGGCTCGATAATGCGTCTG3′
BIP 51 5′GCAACTCAACGCCACGCTTGATCATGCGCCGACTCCACCAGGATCGTTTGG3′