Skip to main content

Table 1 Sequences of PCR primers for amplification of the syrD DNA from Psy

From: Loop-mediated isothermal amplification: a rapid molecular technique for early diagnosis of Pseudomonas syringae pv. syringae of stone fruits

Primer Length (bp) Sequence
F 21 5′AAACCAAGCAAGAGAAGAAGG3′
R 21 5′GGCAATACCGAACAGGAACAC3′